Big Chemical Encyclopedia

Chemical substances, components, reactions, process design ...

Articles Figures Tables About

RAPDs

Naphthalene acetic acid is used to thin apple and pear blossoms and to control apple and pear preharvest drop (10). It also is used to induce flowering in pineapple, but conversely inhibits sprouting in potatoes, sweet potatoes, and turnips (Brassica rapd) (23). It also is used to promote rooting in... [Pg.425]

Twenty populations were sampled with plants from Hailuoto, at 65°00 N, representing the northernmost site and material from Hanko, at 59°49 N, representing the southernmost collection site (and, incidentally, the southernmost point of land in the country). Five samples represented central Finland with the remainder originating from the southern part. Fifty-five compounds were detected by GC-MS analysis, 53 of which were identified. The data obtained were subjected to complete linkage analysis, which differentiated several clusters that corresponded moderately well with geography. Genetic distance values derived from the RAPD data correlated well with chemical distance values determined from the terpene data (r=0.41, P<0.0001). [Pg.45]

Aitken, K., Botero, J., Zwart, R., and Teasdale, R. 1998. Detection of genetic diversity using RAPD markers in the genus Melaleuca. Acta Hort. (ISHS). 461 209-218. [Pg.301]

O. M. 2000. RAPD marker diversity within and divergence among species of Dendroseris (Asteraceae Lactuceae). Amer. J. Bot. 87 591-596. [Pg.311]

Vellekoop, P., Buntjer, J. B., Maas, J. W. and van Brederode, J. 1996. Can the spread of agriculture in Europe be foUowed by tracing the spread of the weed Silene latifolial A RAPD study. Theor. Appl. Gen. 92 1085-1090. [Pg.333]

Vieira, R. F., Grayer, R. J., Paton, A. and Simon, J. E. 2001. Genetic diversity of Ocimum gra-tissimum L. based on volatile oil components, flavonoids and RAPD markers. Biochem. Syst Ecol. 29 287-304. [Pg.333]

Randomly amplified polymeric DNA (RAPD) PCR Repetitive extragenic palindromic (REP) PCR BOX PCR... [Pg.4]

Epe, C., Bienioschek, S., Rehbein, S. and Schnieder, T. (1995) Comparative RAPD-PCR analysis of lungworms (Dictyocaulidae) from fallow deer, cattle, sheep and horses. Journal of Veterinary Medicine B 42, 187-191. [Pg.81]

Gasser, R.B., Bao-Zhen, Q., Nansen, P.,Johansen, M.V. and Bogh, H.O. (1996e) Use of RAPD for the detection of genetic variation in the human blood fluke, Schistosoma japonicum, from mainland China. Molecular and Cellubr Probes 10, 353-358. [Pg.82]

Leignel, V., Humbert, J.F. and Elard, L. (1997) Study by ribosomal DNA ITS2 sequencing and RAPD analysis on the systematics of four Metastrongylus species (Nematoda Metastrongyloidea). Journal of Parasitology 83, 606-611. [Pg.85]

Nadler, S.A., Lindquist, R.L. and Near, T.J. (1995) Genetic structure of midwestem Ascaris suurn populations a comparison of isoenzyme and RAPD markers. Journal of Parasitology 81, 385-394. [Pg.86]

Rodriguez, E., Nieto, J., Castillo, J.A. and Garate, T. (1996) Characterization of Spanish Trichinella isolates by random amplified polymorphic DNA (RAPD). Journal of Helminthology 70, 335-343. [Pg.87]

Wu, Z., Nagano, I. and Takahashi, Y. (1998) The detection of Trichinella with polymerase chain reaction (PCR) primers constructed using sequences of random amplified polymorphic DNA (RAPD) or sequences of complementary DNA encoding excretory-secretory (E-S) glycoproteins. Parasitology 117, 173-183. [Pg.89]

Scanning electron microscopy, light microscopy, and confocal laser scanning microscopy together with FISH Randomly amplified polymorphic DNA (RAPD), Enterobacterial repetitive intergenic consensus sequence (ERIC-PCR)... [Pg.18]

Beebe S, Skroch PW, Tohme J, Duque MC, Pedraza F, Nienhuis J (2000) Structure of genetic diversity among common bean landraces of Middle American origin based on correspondence analysis of RAPD. Crop Sci 40 264-273... [Pg.184]

Haley SD, Miklas PN, Afanador L, Kelly JD (1994) Random amplified polymorphic DNA (RAPD) marker variability between and within gene pools of common bean. J Am Soc Hort Sci 119 122-125... [Pg.185]

Tanaka, H., Fukuda, N., and Shoyama, Y. (2006). Identification and differentiation of Panax species using ELISA, RAPD and eastern blotting. Phytochem. Anal. 17, 46-55. [Pg.95]

Another popular technique for endophyte identification is RFLP (restriction fragment length polymorphism).In this technique, nuclear or mitochondrial DNA is extracted from the endophyte and digested with restriction endonucleases. The digestion products are separated by gel electrophoresis, and a unique pattern emerges for the fungus, similar to the patterns seen in the RAPD-PCR technique. [Pg.513]

Jumpponen A, Spatial distribution of discrete RAPD phenotypes of a root endophytic fungus, Phialocephala fortinii, at a primary successional site on a glacier ioreiront, New Phytol 141 333-344, 1999. [Pg.569]

Aspergillus carbonarius see A. carbonarius RAPD fragment PCR 809 OPX7Fso9 OPX7Rs 9 AGGCTAATGTTGATAACGGATGAT GCTGTCAGTATTGGACCTTAGAG Fungaro et al., 2004... [Pg.85]

See other pages where RAPDs is mentioned: [Pg.12]    [Pg.35]    [Pg.45]    [Pg.265]    [Pg.214]    [Pg.266]    [Pg.11]    [Pg.57]    [Pg.68]    [Pg.68]    [Pg.69]    [Pg.70]    [Pg.3]    [Pg.186]    [Pg.186]    [Pg.106]    [Pg.513]    [Pg.81]    [Pg.88]    [Pg.89]    [Pg.90]    [Pg.90]    [Pg.90]    [Pg.90]    [Pg.90]    [Pg.91]   
See also in sourсe #XX -- [ Pg.55 ]



SEARCH



Genetic markers, RAPD analysis

RAPD analysis

RAPD, (Randomly amplified polymorphic

RAPD-PCR

Random Amplification of Polymorphic DNA RAPD)

Random amplified polymorphic DNA RAPD)

Random amplified polymorphic DNA RAPD)-PCR

Randomly amplified polymorphic DNA RAPD)

© 2024 chempedia.info