Aspergillus carbonarius

Aspergillus carbonarius see A. carbonarius RAPD fragment PCR 809 OPX7Fso9 OPX7Rs 9 AGGCTAATGTTGATAACGGATGAT GCTGTCAGTATTGGACCTTAGAG Fungaro et al., 2004... 

Abarca, M. L., Accensi, F., Bragulat, M. R., Castella, G., and Cabanes, F. J. (2003). Aspergillus carbonarius as the main source of ochratoxin A contamination in dried vine fruits from the Spanish market. /. Food Prot. 66,504-506. 

Atoui, A., Mathieu, F., and Lebrihi, A. (2007). Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using realtime PCR. Int.. Food Microbiol. 115, 313-318. 

Mule, G., Susca, A., Logrieco, A., Stea, G., and Visconti, A. (2006). Development of a quantitative real-time PCR assay for the detection of Aspergillus carbonarius in grapes. Int. J. Food Microbiol. Ill, S28-S34. 

Patino, B., Gonzalez-Salgado, A., Gonzalez-Jaen, M. T., and Vazquez, C. (2005). PCR detection assays for the ochrtoxin-producing Aspergillus carbonarius and Aspergillus ochraceus species. Int.. Food Microbiol. 104, 207-214. 

Schmidt, H., Taniwaki, M. H., Vogel, R. F., and Niessen, L. (2004a). Utilization of AFLP markers for PCR-based identification of Aspergillus carbonarius and indication for its presence in green coffee samples. J. Appl. Microbiol. 97, 899-909. 

Marin S, Belli N, Lasram S, Chebil S, Ramos AJ, Ghorbel A, Sanchis V (2006) Kinetics of Ochratoxin A Production and Accumulation by Aspergillus carbonarius on Synthetic Grape Medium at Different Temperature Levels. J Food Sci 71 M196... 

Atoui, A., Mitchell, D., Mathieu, F, Magan, N., Lebrihi, A. (2007). Partitioning of ochratoxin A in mycelium and conidia of Aspergillus carbonarius and the impact on toxin contamination of grapes and wine. J. Appl. Microbiol, 103, 961-968. 

Belli, N., Marin, S., Coronas, I., Sanchis, V, Ramos, A.J. (2007). Skin damage, high temperature and relative humidity as detrimental factors for Aspergillus carbonarius infection and ochratoxin A production in grapes. Food Control, 18, 1343-1349. 

OTA is an organic compound that does have IR absorbance however, it is present in concentrations (some p.g/L) that are too low to permit its direct determination. In this particular case it has been demonstrated that Aspergillus carbonarius, the organism responsible for the production of OTA, also produces other organic... 

Mitchell, D., Aldred, D., and Magan, N. 2003. Impact of ecological factors on the growth and ochratoxin A production by Aspergillus carbonarius from different regions of Europe. Mycotoxins in food production systems. Bath, UK, 25-2 June 2003. 

Aspergillus carbonarius, A. niger ar d A. japonicus occur together in foods and superficially look similar, so many surveys of Aspergilli in foods have not differentiated these three species, calling all black Aspergilli A. niger. 

Estaban, A., Abarca, M.L., Bragulat, M.R. Cabanes, F.J. (2006a) Studyof the effect of water activity and temperature on ochratoxin A production by Aspergillus carbonarius. Food Microbiol. 23, 634-640. 

Leong, S.-L., Hocking, A.D. Scott, E.S. (2006a) Effects of temperature and water activity on growth and ochratoxin A production by Austraiian Aspergillus carbonarius and A. niger isoiates on a simuiated grape juice medium. Int. J. Food Microbiol. 110, 209-216. 

Romero, S.M., Patriarca, A., Fernandez Pinto, V. Vaamonde, G. (2007) Effect of water activity and temperature on growth of ochratoxigenic strains of Aspergillus carbonarius isoiated from Argentinian dried vine fruits. Int. J. Food Microbiol. 115,140-143. 

Joosten, H. M. L. J., Goetz, J., Pittet, A., Schellenberg, M., Bucheli, P. (2001). Production of ochratoxin A by Aspergillus carbonarius on coffee cherries. International Journal of Food Microbiology, 65, 39-44. 

Battilani, R, a. Logrieco, P. Giorni, G. Gozzi, T. Bertuzzi, and A. Pietri. 2004. Ochratoxin A production by Aspergillus carbonarius on some grape varieties grown in Italy./. Sci. Food Agric. 84 1736-1740. 

---