Minisatellites and

Other genetic markers may be identified in this way, such as minisatellite and microsatellite sequences (see Qiapter 7). 

Meyer W Mitchell TG (1995) Polymerase chain reaction fingerprinting in fungi using single primers specific to minisatellites and simple repetitive DNA sequences strain variation in Cryptococcum neoformans. Electrophoresis 16 1648-1656. 

Debrauwere, H., C. G. Gendrel, S. Lechat, and M. Dutreix. 1997. Differences and similarities between various tandem repeat sequences Minisatellites and microsatellites. Biochimie 79 577-86. 

Jeffreys, A.J. 1987 Highly variable minisatellites and DNA fingerprints. Biochem. Soc. Trans. 15 309-317. 

Minisatellites-the repeated unit typically ranges from 20 to 70 bp, and the length of the entire repeat may reach 20 kb. This is the class most often referred to as VNTRs and contributes to RFLP patterns on Soulhem blots. 

VNTRs (variable number of tandem repeats). These polymorphisms are the result of varying numbers of minisatellite repeats in a specific region of a chromosome. The repeat units typically range in size from 20 to 70 bases each. The repeat is flanked on both sides by a restriction site, and variation in the number of repeats produces restriction fragments of varying size. 

A form of epilepsy (Table 27-4) appears to be a result of repeats of a (G + C)-rich sequence that may be a dodecamer.405 Dinucleotide repeats and other "minisatellite" DNA sequences are also associated with instability of DNA and may undergo expansion.419 21 A pentanucleotide repeat (CCTTT) is associated with increased expression of the nitric oxide synthase gene NOS2A. Persons with n = 14 were found to have enhanced resistance to development of diabetic retinopathy. This seems to be a case of a beneficial "gain of function" mutation.422... 

Rapid rearrangement of a polymorphic minisatellite within the D-loop/control region of the 5. mansoni mitochondrial genome has also been reported by various authors (Minchella et al., 1994 Bieberich and Minchella, 2001 Jannolti-Passos et al., 2001). These observations are discussed in detail in the section entitled Maternal Inheritance. ... 

Pena, H.B., de Souza, C.P., Simpson, A.J. and Pena, S.D. (1995) Intracellular promiscuity in Schistosoma mansoni nuclear transcribed DNA sequences are part of a mitochondrial minisatellite region. Proceedings of the National Academy of Sciences USA 92, 915-919. 

The human kallikrein locus contains a unique minisatellite element that is restricted to chromosomal band 19ql3, and ten clusters of this minisatellite are distributed along the kallikrein locus. These clusters are mainly located... 

Galvin, P., Sadusky, D., McGregor, D. and Cross, T. (1995). Population genetics of Atlantic cod using amplified single locus minisatellite VNTR analysis. Journal of Fish Biology 47(suppl. A), 200-208. 

A delineated class of DNA, minisatellite DNA, has been found to be moderately to extremely variable in certain eukaryote genomes.1-3 Minisatellite DNA is composed of tandem repeats of a core or consensus sequence reiterated a low to moderate number of times (relative to satellite DNA, where consensus motifs, or variants thereon, may be repeated tens of thousands of times). For convenience, minisatellite DNA as defined here includes simple sequence4 and microsatellite5 DNA. Thus, minisatellite consensus sequences range from 2 to approximately 70 base pairs (bp). Several different minisatellite families (members of a family have consensus sequence similarities) have been described.6... 

Previously described methods for plant DNA extraction (e.g., see Hillis et al.16 and references therein) have usually either required CsCl purification or resulted in a final DNA product that often contained other contaminating substances. For restriction site analysis of chloroplast or mitochondrial genomes, where usually less than 0.5 fig of DNA per individual is required, any procedure was appropriate and practical. However, for minisatellite restriction enzyme analyses, typically 5-10 jtg of DNA is required per individual per trial. For such analyses, obtaining enough DNA from an individual for several trials using CsCl is costly and time-consuming ... 

Using the M13 sequence (GenBank), synthesize primers for the complementary strands that can be used to amplify the minisatellite sequence (e.g., 20-mers 5 TGTAGTTTGTACTGGTGACG and 5 CCTTATTAGCGTTTGCCATC). 

In conclusion, these results further open the door to the creation of numerous minisatellite probes to survey for VNTR loci. Such probes can be used not only for restriction fragment length polymorphism (RFLP) analyses of the many biological applications outlined in the introduction, but they can also be employed to screen cloned libraries with the ultimate goal of determining the sequences flanking VNTR loci. The latter information provides perhaps the most accurate and rapid means of utilizing the variation at such loci via the PCR analysis of alternate alleles. 

The next major change in the analysis of the DNA for paternity (and forensic) analysis incorporated the PCR amplification of microsatellites instead of minisatellites. Microsatellites are also formed by tandem repeats but consist of two to five nucleotides per repeat units. This means that the amplification requires less DNA (less than 1 ng) and the quality of the material may be less than ideal. This capability permits the analysis of some degraded DNAs. The potential number of loci is very large and the process is rapid it may be completed in a day or two. This system also has the benefit of lending itself to multiplexing and automation. In addition, several kits are available, and for some multiplexes inexpensive silver stain materials may be employed without expensive equipment. 

Armour JA, Tael I, Thein SL, Fey MF Jeffreys AJ (1989) Analysis of somatic mutations at human minisatellite loci in tumours and cell lines. Genomics 4 328-334. 

Devor EJ, Ivanovich AK, Hickok JM Todd RD (1988) A rapid method of confirming cell line identity DNA fingerprinting and minisatellite probe from M13 bacteriophage. Biotechniques 6 200-202. 

Vassart G, Georges M, Monsieur R, Brocas H, Lecarre AS Christophe D (1987) A sequence in M13 phage detects hypervariable minisatellites in human and animal DNA. Science 235 683-684. 

---