Minisatellite sequences

Obtain DNA from any strain of the M13 bacteriophage (commercially available) that has the minisatellite sequence indicated by Vassart et al ... 

Using the M13 sequence (GenBank), synthesize primers for the complementary strands that can be used to amplify the minisatellite sequence (e.g., 20-mers 5 TGTAGTTTGTACTGGTGACG and 5 CCTTATTAGCGTTTGCCATC). 

The genomic DNA isolated is a suitable substrate for digestion with a variety of restriction enzymes. Ideally a restriction enzyme is chosen which cuts frequently in most genomic DNA but not within tandemly repeated minisatellite sequences, a variety of such four base pair restriction enzymes exist, e.g. Hae III, Alu I and Hint I, although their suitability varies with different species. 

In 1985 a British chemist named Alec Jeffreys suggested that minisatellite sequences provide a means of identification, much like fingerprints. DNA fingerprinting has since gained prominence with law enforcement officials as a way to identify crime suspects. 

Other genetic markers may be identified in this way, such as minisatellite and microsatellite sequences (see Qiapter 7). 

A form of epilepsy (Table 27-4) appears to be a result of repeats of a (G + C)-rich sequence that may be a dodecamer.405 Dinucleotide repeats and other "minisatellite" DNA sequences are also associated with instability of DNA and may undergo expansion.419 21 A pentanucleotide repeat (CCTTT) is associated with increased expression of the nitric oxide synthase gene NOS2A. Persons with n = 14 were found to have enhanced resistance to development of diabetic retinopathy. This seems to be a case of a beneficial "gain of function" mutation.422... 

Pena, H.B., de Souza, C.P., Simpson, A.J. and Pena, S.D. (1995) Intracellular promiscuity in Schistosoma mansoni nuclear transcribed DNA sequences are part of a mitochondrial minisatellite region. Proceedings of the National Academy of Sciences USA 92, 915-919. 

Yousef GM, Bharaj BS, Yu H, Poulopoulos J, Diamandis EP. Sequence analysis of the human kallikrein gene locus identifies a unique polymorphic minisatellite element. Biochem Biophys Res Commun 2001 285 1321-1329. 

A delineated class of DNA, minisatellite DNA, has been found to be moderately to extremely variable in certain eukaryote genomes.1-3 Minisatellite DNA is composed of tandem repeats of a core or consensus sequence reiterated a low to moderate number of times (relative to satellite DNA, where consensus motifs, or variants thereon, may be repeated tens of thousands of times). For convenience, minisatellite DNA as defined here includes simple sequence4 and microsatellite5 DNA. Thus, minisatellite consensus sequences range from 2 to approximately 70 base pairs (bp). Several different minisatellite families (members of a family have consensus sequence similarities) have been described.6... 

The different alleles at a minisatellite locus are thought to vary in the number of repeats of the consensus sequence, hence the name variable number of tandem repeats (VNTR) locus.7 For some human VNTR loci... 

In conclusion, these results further open the door to the creation of numerous minisatellite probes to survey for VNTR loci. Such probes can be used not only for restriction fragment length polymorphism (RFLP) analyses of the many biological applications outlined in the introduction, but they can also be employed to screen cloned libraries with the ultimate goal of determining the sequences flanking VNTR loci. The latter information provides perhaps the most accurate and rapid means of utilizing the variation at such loci via the PCR analysis of alternate alleles. 

In the mid-1980s, these techniques were replaced by direct analysis of the DNA polymorphisms. The first of such techniques, developed by Alec Jeffries utilized multilocus DNA probes. This technique is known as the restriction fragment length polymorphism (RFLP) testing. RFLP techniques are based on variable number of tandem repeats (VNTR), which are sequences of 10 to 60 bp (base pairs) of length, that lie adjacent to each other in the same chromosomal orientation (minisatellites). 

Vassart G, Georges M, Monsieur R, Brocas H, Lecarre AS Christophe D (1987) A sequence in M13 phage detects hypervariable minisatellites in human and animal DNA. Science 235 683-684. 

Meyer W Mitchell TG (1995) Polymerase chain reaction fingerprinting in fungi using single primers specific to minisatellites and simple repetitive DNA sequences strain variation in Cryptococcum neoformans. Electrophoresis 16 1648-1656. 

Debrauwere, H., C. G. Gendrel, S. Lechat, and M. Dutreix. 1997. Differences and similarities between various tandem repeat sequences Minisatellites and microsatellites. Biochimie 79 577-86. 

The human genome contains approximately 3 billion base pairs (bp) of DNA. The DNA is folded to fit within the nucleus. It is divided among chromosomes and compactly packed into chromatin by histones and other accessory proteins. Each normal somatic cell contains two copies of 22 different somatic chromosomes and two sex chromosomes (XX or XY). Less than 5% of DNA actually encodes protein and other functional products, such as tRNA, rRNA, miRNA, and other small nuclear RNAs. The majority (>95%) of human DNA consists of non-coding sequences, typically repetitive sequences such as minisatellites, microsatellites, SINEs, and LINEs. Microsatellites are short tandem repeats with each repeat unit of 1 to 13 bp long. Mini-satellites are tandemly repeated DNA sequences with the size of repeat unit of 14 to 500 bp. Microsatellite and minisatellite repeats are also known as short tandem repeats (STRs). Highly repetitive sequences containing thousands of repeated units are also found at the... 

---