Fast-flow

Seeley J V, Jayne J T and Molina M J 1993 Fligh pressure fast-flow teohnique for gas phase kinetios studies Int. J. Chem. Kinet. 25 571-94... 

One of the major limiting factors for the time resolution of flow-hibe experiments is the time required for mixing reactants and—to a lesser extent—the resolution of distance. With typical fast flow rates of more than 25 ms [42, 43] the time resolution lies between milliseconds and microseconds. 

Bergeat A, Calvo T, Dorthe G and Loison J-C 1999 Fast-flow study of the OH + OH reaction products J. Phys. Chem. A 103 6360-5... 

Figure 19.7 shows a typical construction of a concentric-tube nebulizer. The sample (analyte) solution is placed in the innermost of two concentric capillary tubes and a flow of argon is forced down the annular space between the two tubes. As it emerges, the fast-flowing gas stream causes a partial vacuum at the end of the inner tube (Figure 19.4), and the sample solution lifts out (Figure 19.5). Where the emerging solution meets the fast-flowing gas, it is broken into an aerosol (Figure 19.7), which is swept along with the gas and eventually reaches the plasma flame. Uptake of sample solution is commonly a few milliliters per minute.

The fast-flowing narrow liquid stream has a high relative linear velocity with respect to the slower flow of the argon gas stream. This leads to breaking up the liquid stream into fast-moving droplets, which strike the impactor bead and form much smaller droplets. 

The flows of gas and liquid need not be concentric for aerosol formation and, indeed, the two flows could meet at any angle. In the cross-flow nebulizers, the flows of gas and sample solution are approximately at right angles to each other. In the simplest arrangement (Figure 19.11), a vertical capillary tube carries the sample solution. A stream of gas from a second capillary is blown across this vertical tube and creates a partial vacuum, so some sample solution lifts above the top of the capillary. There, the fast-flowing gas stream breaks down the thin film of sample... 

DEAF Sepharose Fast Flow LC DEAF Sepharose Fast Flow HC DEAF. Spherodex M DEAF. Spherosil M DEAF. Trisacryl Plus M Toyopead DEAE-650 (M) Fractogel EMD DMAE-650 (M) Fractogel EMD DEAE-650 (M) Q Sepharose Fast Flow QMA Spherodex M QMA Spherosil M QMA Trisacryl Plus M Toyopead QAE-550 C SP Sepharose Fast Flow SP Sepharose High Performance SP Sepharose Big Bead SP Trisacryl Plus M Toyopead SP-650 M Fractogel EMD SO -650 M... 

Irradiation of ethyleneimine (341,342) with light of short wavelength ia the gas phase has been carried out direcdy and with sensitization (343—349). Photolysis products found were hydrogen, nitrogen, ethylene, ammonium, saturated hydrocarbons (methane, ethane, propane, / -butane), and the dimer of the ethyleneimino radical. The nature and the amount of the reaction products is highly dependent on the conditions used. For example, the photoproducts identified ia a fast flow photoreactor iacluded hydrocyanic acid and acetonitrile (345), ia addition to those found ia a steady state system. The reaction of hydrogen radicals with ethyleneimine results ia the formation of hydrocyanic acid ia addition to methane (350). Important processes ia the photolysis of ethyleneimine are nitrene extmsion and homolysis of the N—H bond, as suggested and simulated by ab initio SCF calculations (351). The occurrence of ethyleneimine as an iatermediate ia the photolytic formation of hydrocyanic acid from acetylene and ammonia ia the atmosphere of the planet Jupiter has been postulated (352), but is disputed (353). 

It is a consequence of the action of different pH values in the aeration cell that these cells do not arise in well-buffered media [4] and in fast-flowing waters [5-7]. The enforced uniform corrosion leads to the formation of homogeneous surface films in solutions containing Oj [7-9]. This process is encouraged by film-forming inhibitors (HCOj, phosphate, silicate, Ca and AP ) and disrupted by peptizing anions (CP, SO ") [10]. In pure salt water, no protective films are formed. In this case the corrosion rate is determined by oxygen diffusion [6,7,10]... 

The family of agarose-based gels, Sepharose, Sepharose CL, and Sepharose Fast Flow, are bead-formed gels prepared from 2, 4, or 6% agarose solutions. The matrix porosity decreases and rigidity of the bead structure increases with increasing agarose concentrations. The open pore structure and broad... 

Maximum operating linear velocities and pressures were determined in 2.5 X 30-cm beds for Sepharose and Sepharose CL media and with 5 X 15-cm beds for Sepharose fast flow gels, assuming pure/water as mobile phase. 

Both processes rely on a fast flow system and the rapid quenching of product gases yields of up to 90% can be attained. It is salutory to note that US production of this highly toxic compound is 600000 tonnes pa (1992) and world production exceeds one million tonnes pa. Of this, 41% is used to manufacture adiponitrile for nylon and 28% for acrylic plastics ... 

The protein can be further purified by hydrophobic interaction chromatography on a column of Butyl Sepharose 4 Fast Flow (Pharmacia elution with decreasing concentration of (NH4)2S04 starting at 1.5 M), and gel filtration on a column of Superdex 200 Prep (Pharmacia Inouye et al., 2000). 

Challis and Long497 have used the fast flow technique described above (p. 217) to measure the equilibrium protonation of azulene in a range of aqueous perchloric acid media at 7.5 °C and hence the rates of the forward protonation and reverse deprotonation, the overall exchange rate being the sum of these. Some representat i ve values are given in Table 141. Coupled with data obtained at other temperatures... 

The stopped-flow and quenched-flow methods for fast reactions involve the fast flowing together of separate solutions of the reactants. This rapid mixing can be coupled to a rapid-response method for monitoring the progress of the reaction. With such methods one can determine rate constants up to about 5 X 102 s 1 (i.e., t n > 1 ms). The instrumentation for stopped-flow kinetics is readily available commercially. With special adaptations, one can gain another one or two orders of magnitude. 

Fig. 5 Decrease of surface water and the effects on the longitudinal distribution of riverine habitats. During high flow (a) surface habitats, i.e. riffle (fast flowing sections) and pools (slow flowing sections), are available. Drying first affects the surface waters (b), causing fragmentation and the formation of remaining pools (c). During this phase the hyporheic compartment is also restricted to the pool habitats. Finally, both the superficial and hyporheic compartments dry completely up, and potential refuge for the aquatic biota disappear...

The main limitation of HEX reactors is the short residence time, typically from a few seconds to a few minutes. Indeed, the apparatuses are smaller than the traditional ones and fast flow velocities are necessary in order to maintain good level of heat-transfer coefficients. However, as described in the previous paragraph, the highlighted transfer properties of HEX reactors allow us to operate in a few minutes, whereas it takes many hours in batch or semibatch mode. 

ChSS was fractionated on a column (550 x 15 mm) of DEAE Sepharo e Fast Flow using a Hiload System (Pharmacia), which was initially equilibrated in 0.005 M NaAc-bufFer pH 5.0. The sample was dissolved in water, the insoluble residue was removed by centrifugation and the supernatant was applied onto the column. After applying the gradient shown in Figure 1, the residual polysaccharides were washed from the column using 0.5 M NaOH. Fractions (23 ml) were collected and assayed by automated methods [2,3] for total neutral sugars and uronic acids. 

Figure 1. Elution profile of ChSS on DEAE Sepharose Fast Flow. Eluent molarity (. galacturonic acid ( ) and neutral sugars ( ).

Fluted filter-paper, 6-cm diameter, fast flow rate, extracted exhaustively with acetone Membrane filter, 0.45-p.m pore size, 25-mm diameter (e.g., Chromafll, Type 0-45/25 organic, Macherey-Nagel No. 718 005)... 

Filter the homogenate with suction through a fast flow-rate filter-paper in a Buchner funnel until more than 200 mL of filtrate is obtained. Apply only gentle suction to avoid the loss of acetone by evaporation therefore, do not allow the filter cake to pull dry. The filtration should take not more than 1 min. 

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

Ferric ion was immobilized on a Chelating Sepharose Fast Flow column preparatory to the separation of seven enkephalin-related phosphopep-tides.17 Non-phosphorylated peptides flowed through the column, and the bound fraction contained the product. The capacity of the column was found to be 23 pmol/mL by frontal elution analysis. Cupric ion was immobilized on Chelating Superose for the isolation of bovine serum albumin.18 Cupric ion was immobilized on a Pharmacia HiTrap column for the separation of Protein C from prothrombin, a separation that was used to model the subsequent apparently successful separation of Factor IX from prothrombin Factor IX activity of the eluate was, however, not checked.19 Imidazole was used as the displacement agent to recover p-galactosidase from unclarified homogenates injected onto a nickel-loaded IMAC column.20 Pretreatment with nucleases and cleaning in place between injections were required procedures. A sixfold purification factor was observed. 

---