Tangential-flow filtration

Dornase alfa is produced by genetically engineered Chinese Hamster ovary cells containing DNA encoding for the native human protein deoxyribunuclease I. It is purified by tangential flow filtration and column chromatography. 

Flow Types Normal Flow and Tangential Flow Filtration If... 

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

Table 6. Overview of reported perfusion processes employing tangential flow filtration units as cell retention device...

Kempken et al. [113] employed a rotating disc filter to harvest CHO cells, and observed that the filter could be operated at low transmembrane-pressure with high wall shear rates, leading to high filtrate flow rates, high product yields and minimum fouling. They concluded that their system offered a powerful alternative to conventional tangential flow filtration. 

Filtration separates components according to their size. Efficiency depends on the shape and compressibility of the particles, the viscosity of the liquid phase and the driving force, which is the pressure created by overpressure or by vacuum. Filtration can be performed either as dead-end filtration, where the feed stream flows perpendicular to the filter surface (Lee, 1989) or as tangential flow filtration, where the feed stream flows parallel to the filter and the filtrate diffuses across it. Examples of the former are the continuous rotaiy vacuum dram filter, where a rotaiy vacuum filter has a filter medium covering the surface of a rotating drum and the filtrate is drawn through the dram by an... 

Van Reis R, Leonard LC, Hsu CC, Builder SE. Industrial scale harvest of proteins from mammalian cell culture by tangential flow filtration. Biotechnol Bioeng 1991 38 413 22. 

All of the membrane processes utilize an engineering design known as "cross-flow" or "tangential flow" filtration. in this mechanism, the bulk solution flows over and parallel to the membrane surface, and because the system is pressurized, water is forced through the membrane. The turbulent flow of the bulk solution across the surface minimizes the accumulati.on of particulate matter on the membrane and facilitates the continuous operation of the system. 

Unlike sterilizing and virus removal filters, tangential flow filtration (TFF) filters are often reused. Flow and integrity tests are necessary to ensure the filter remains the same after usage and cleaning. Consistency of filtrate and retentate streams is validated using relevant validated assays that are specific for each process and product. 

Bobrowski, A., B. Bas, J. Dominik, et al. 2004. Chromium speciation study in polluted waters using catalytic adsorptive stripping voltammetry and tangential flow filtration. Talanta 63 1003-1012. 

---