Sepharose® Fast Flow

DEAF Sepharose Fast Flow LC DEAF Sepharose Fast Flow HC DEAF. Spherodex M DEAF. Spherosil M DEAF. Trisacryl Plus M Toyopead DEAE-650 (M) Fractogel EMD DMAE-650 (M) Fractogel EMD DEAE-650 (M) Q Sepharose Fast Flow QMA Spherodex M QMA Spherosil M QMA Trisacryl Plus M Toyopead QAE-550 C SP Sepharose Fast Flow SP Sepharose High Performance SP Sepharose Big Bead SP Trisacryl Plus M Toyopead SP-650 M Fractogel EMD SO -650 M... 

The family of agarose-based gels, Sepharose, Sepharose CL, and Sepharose Fast Flow, are bead-formed gels prepared from 2, 4, or 6% agarose solutions. The matrix porosity decreases and rigidity of the bead structure increases with increasing agarose concentrations. The open pore structure and broad... 

Maximum operating linear velocities and pressures were determined in 2.5 X 30-cm beds for Sepharose and Sepharose CL media and with 5 X 15-cm beds for Sepharose fast flow gels, assuming pure/water as mobile phase. 

Figure 1. Elution profile of ChSS on DEAE Sepharose Fast Flow. Eluent molarity (. galacturonic acid ( ) and neutral sugars ( ).

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

Ferric ion was immobilized on a Chelating Sepharose Fast Flow column preparatory to the separation of seven enkephalin-related phosphopep-tides.17 Non-phosphorylated peptides flowed through the column, and the bound fraction contained the product. The capacity of the column was found to be 23 pmol/mL by frontal elution analysis. Cupric ion was immobilized on Chelating Superose for the isolation of bovine serum albumin.18 Cupric ion was immobilized on a Pharmacia HiTrap column for the separation of Protein C from prothrombin, a separation that was used to model the subsequent apparently successful separation of Factor IX from prothrombin Factor IX activity of the eluate was, however, not checked.19 Imidazole was used as the displacement agent to recover p-galactosidase from unclarified homogenates injected onto a nickel-loaded IMAC column.20 Pretreatment with nucleases and cleaning in place between injections were required procedures. A sixfold purification factor was observed. 

Chase, H. A., Macheilse, B., and Naveh, D., Characteristics of the adsorption of immunoglobulin M onto Q Sepharose Fast Flow ion-exchangers, Bioseparation, 7, 47, 1997. 

Q Sepharose Fast Flow resin (Pharmacia Biotech) tris buffer... 

Chelating Sepharose Fast Flow Chelating Sepharose Fast Flow ... 

DEAE-Sepharose fast flow anion-exchange chromatography column (10 x 300 mm)... 

Elimination of coextracted materials and concentration of tetracyclines have also been accomplished using mixed-phase extraction membranes with both re-versed-phase and cation-exchange properties (294,295), or solid-phase extraction columns packed with cation-exchange materials such as CM-Sephadex C-25 (301), aromatic sulfonic acid (310), and carboxylic acid (283, 300). For the same purpose, metal chelate affinity chromatography has also been employed. In this technique, the tetracyclines are specifically absorbed on the column sorbent by chelation with copper ions bound to small chelating Sepharose fast flow column (278-281, 294-296). 

This approach was used for the determination of OTC, TC, and CTC in milk samples. The centrifuged raw milk was mixed with succinate buffer (pH 4.0) to precipitate proteins. The clear supernatant was loaded directly on an MCAC column (1.5-ml Chelating Sepharose Fast-Flow) activated by passage of both water and 10 mM copper(II) sulphate solution. The blue-colored column was washed with both water and MeOH, and TCs were eluted with McIlvaine/EDTA/NaCl buffer. The extract was injected directly into the chromatographic system (25). 

For fast and simple purification of RNA oligonucleotides from crude transcription reactions, we use an AKTA prime FPLC system equipped with a 50-ml superloop and three 5 ml HiTrap diethylaminoethyl (DEAE) sepharose Fast-Flow columns (GE Healthcare) connected in series. The DEAE columns are equilibrated with 3 CV of buffer A (50 mM sodium phosphate, pH 6.5, 150 mMsodium chloride, and 0.2 mMEDTA) at room temperature. Buffer B contains the same components with 2 Msodium chloride. Both buffers can be prepared in large quantities, sterile filtered and stored at 4 °C (buffer A) or room temperature (buffer B) to avoid precipitation of sodium chloride. 

Faster processing of IgG with a Q Sepharose Fast Flow, Downstream 20 61-17(1995). 

Protein Production, Isolation, and Purification. The expression and purification of chicken lysozyme mutant proteins in yeast are performed as described by Malcolm et al. with the following modifications. The 50-ml minimal medium second seed yeast culture is used to inoculate a 2.8-liter Fembach flask containing 500 ml of 1% yeast extract/2% Bacto-peptone/ 8% glucose (w/v) medium and is then incubated for 7 - 9 days at 30°. Cells are harvested, washed twice with 60 ml of 0.5 M NaCl, and collected by centrifugation. The supernatants are pooled, diluted 5-fold with deionized water, and loaded onto a 20-ml column of CM Sepharose Fast Flow (Pharmacia, Piscataway, NJ) equilibrated with 0.1 M potassium phosphate, pH 6.24. The column is washed with the same buffer, and lysozyme is eluted with 0.5 M NaCl/0.1 M potassium phosphate, pH 6.24. Fractions are assayed by activity (decrease in A450 of Micrococcus lysodeikticus cell wall suspensions per minute). Fractions containing lysozyme are concentrated in Centricon-10 (Amicon, Danvers, MA) filter units, washed with 0.1 M potassium phosphate buffer, pH 6.24, and stored at 4°. The protein concentration is determined from e 1 = 26.4.15... 

The combined culture supernatant and cell wash are centrifuged at 16,000 g, 4°, for 20 min to remove residual cells and debris. The supernatant is loaded onto a 1.9 X 14 cm column containing 30 ml of CM Sepharose Fast Flow resin (Pharmacia, Piscataway, NJ) previously equilibrated in KP 6.2 at 4° using a peristaltic pump at a rate of approximately 10 ml/min. 

---