Vector sequencing

If an antibody to the protein of interest is available, it is sometimes possible to use vector sequences, eg, the beta-galactosidase promoter sequence, to direct the transcription of the passenger DNA into messenger RNA and the translation of that mRNA into protein which can be recognized by the antibody. Although this method is somewhat less reHable than the use of nucleic acid probes, specialized vectors are available for this purpose. 

Figure 4.7. In vivo recombinational cloning in yeast. Two successive PCR reactions are performed. Each set of primers contains 5 flanking sequences that are eventually used for homologous recombination with vector sequences after transformation of yeast with the 2nd PCR fragment and the linearized vector.

For preparation of donor DNAs, 2 pg of the cDNA clones carrying the desired ORF are linearized by a restriction enzyme that can cleave the vector sequence but not ORF (teeNote 8). Prepared cDNAs are digested in 50 pL of a reaction mixture with 20 U of the restriction enzyme at the appropriate temperature for the enzyme for 1 h in a 96-well format, and the enzyme is inactivated by heating the reaction mixture whose condition is suitable for the enzyme. 

The LIC system is adaptable for use with any vector following an alteration of the vector sequence. This chapter describes the creation of an LIC-compatible vector, with tips on how to make any vector LIC-enabled. It also includes a protocol for generating high-quality linearized vector template for the LIC reaction. Lastly, a step-by-step protocol of the LIC reaction is outlined, with useful tips and tricks for optimization and screening. 

It is beneficial to identify clones that contain the correct insert prior to plasmid purification and sequencing. The following protocol for colony PCR utilizes primers that anneal to the vector sequence, which is advantageous because one optimized set of PCR conditions is used. This allows for easy preparation, and avoids problems related to different primer conditions. In addition, a negative control of vector DNA can serve as a built-in control for the reaction. Primers should be chosen that produce a product of approx 100 bp when vector DNA without insert is amplified. To amplify the pNHis vector, the T7 promoter (5 TAATACGACTCACTATAGGG 3 ) and T7 terminator (5 GCTAGTTATT GCTCAGCGG 3 ) primers were used. 

K. A. High. 2001. Lack of germline transmission of vector sequences following systemic administration of recombinant AAV-2 vector in males. Mol. Ther. 4 586-592. 

In recent years, there have been significant improvements in production and purification of rAAV vectors. The major improvements in production have included enhanced output of the number of DNase resistant particles (drp) per cell and the emergence of scaleable systems. The most widely utilized rAAV vector production methods require four genetic elements (Hermonat and Muzyczka, 1984 Tratschinetal., 1984) (1) mammalian tissue culture cells, (2) vector sequences containing a transgene flanked by AAV inverted terminal repeats, (3) AAV helper sequences comprising... 

Type name of file of consensus and/or vector sequence file names FILE OF MASTER FILE NAMES = This must be written beforehand using a system editor. 

Presence of vector sequence via Q-PCR analysis Dissemination of vector to nontarget tissues Dissemination of vector to the germline Vector persistence and clearance profile... 

The presence of a vector sequence in nontarget tissues at significant levels should suggest the need for further analysis of the tissue to determine the levels of transgene expressed. These data, coupled with results of other safety endpoints, such as clinical pathology and histopathology evaluation, will determine whether vector presence or gene expression is correlated with any detrimental effects on the tissue. 

The algorithm is based on the calculation of a row of X in vector sequences. The FORTRAN code in Figure 6 gives a picture of the procedure, but must be coded in CAL, with all vectors labeled Vx being directly replaced by V registers - their dimension is always... 

The procedure is to produce the columns of the result in vector sequences. The algorithm comprises a simple modification of that detailed for Algorithm 1. Vector orders of NROW in length are produced, and the sparsity of the Q matrix can be taken advantage of. 

The second component of an expression vector comprises DNA sequences required for the selection, maintenance and copy-number amplification of the vector in the host cell wherein protein expression is desired. Obviously, this region is not needed for expression in E. coli. The selectable markers used in other host cells may be an enzyme conferring the ability to produce a nutrient essential for growth of the host cell, or transformation of cell morphology, or resistance to antibiotics (such as hygromycin or geneticin). Sequences for the maintenance of the vector DNA are required for the autonomous replication of the plasmid in these host cells except in cases where the vector sequences Tntegrate into chromosomes of the... 

Trials of gene therapy in hemophilia A and B, to determine safety and efficacy, are under way (2). Three patients with hemophilia B were treated in a phase I trial with a recombinant adenovirus-associated vector expressing human blood-coagulation factor IX (3). There was no evidence of formation of inhibitory antibodies against factor IX. In a phase I trial with a recombinant adenovirus-associated vector expressing human blood-coagulation factor IX, there was no evidence of germ-line transmission of vector sequences (3). 

Cleave 10-200 pg cloned viral genome (or other replicon DNA) with appropriate enzyme to remove vector sequences. BamRl removes the pML2d vector from pl42-6 (Note 13). 

---