Vectors pNHis

N-terminal hexahistidine affinity tag. The new vector, pNHis, encodes a protein with anN-terminal extension of six histidine residues followed by six additional amino acids that encode a Factor Xa cleavage site. A stop codon was added to the gene sequence so that the 3 LIC sequence did not add six extra amino acids to the C-terminus of the protein sequence. 

Fig 2. Ligation-independent cloning (LIC) using the pNHis vector. The bold type denotes the LIC sequences of the vector, which contains the BseR I recognition sequence (underlined). The complementary LIC sequences of the insert DNA are shown in italics. 

Amplify genes of interest using a high-fidelity polymerase (such as Platinum Pfx polymerase) with primers that contain 5 extensions for LIC. For the pNHis vector, the forward primer uses the extension 5 GGTATTGAGGGTCGC, followed by the cDNA sequence starting with the second codon. The reverse primer uses the extension 5 AGAGGAGAGTTAGAGCCTTA. Note that a stop codon is added to this sequence so that the product does not contain additional amino acids encoded by the LIC sequence (see Note 4). 

It is beneficial to identify clones that contain the correct insert prior to plasmid purification and sequencing. The following protocol for colony PCR utilizes primers that anneal to the vector sequence, which is advantageous because one optimized set of PCR conditions is used. This allows for easy preparation, and avoids problems related to different primer conditions. In addition, a negative control of vector DNA can serve as a built-in control for the reaction. Primers should be chosen that produce a product of approx 100 bp when vector DNA without insert is amplified. To amplify the pNHis vector, the T7 promoter (5 TAATACGACTCACTATAGGG 3 ) and T7 terminator (5 GCTAGTTATT GCTCAGCGG 3 ) primers were used. 

---