Ethyl p-nitrophenyl phosphat

Polymers 33, 34, and 35 showed high catalytic activities for the hydrolysis of phosphodiester substrate (ethyl p-nitrophenyl phosphate) while no activity was observed for 36 and 37. The were found to be 0.42, 0.90, and 0.17 h for 33, 34, and 35, respectively, which were about 10 -fold faster than that (9.12X 10 h ) of the uncatalyzed reaction. These results showed that vic-cis-diols of ribose were responsible for the catalysis and that the carboxyl groups played no significant roles. The activation energy of the catalysis for polymer 33 was found by an Arrhenius plot to be 6.9kcal/mol, which was 6.6kcal/mol lower than that (13.5kcal/mol) of the uncatalyzed reaction. 

P-labeled on 5 of ss DNA of 30 bases, (CATGGCAAAGCCAGTATACA AATTGTAATA), corresponding to the human foamy virus proviral DNA in the position of nucleotide 3643-3611, was incubated in a Tris buffer (pH 7.4) at 37 °C and ionic strength 0.02 (KCl) in the presence of polymers 33-36. Autoradiograms of acrylamide gel electrophoretic analysis of the reaction mixtures are shown in Fig. 16. No DNA cleavage occurred in the buffer or in the presence of 36, while polymers 33-35 catalyzed hydrolysis of DNA, as was observed in the hydrolysis of ethyl p-nitrophenyl phosphate substrate [99, 100]. 

Bunton CA, Diaz S, HeUyer JM, Ihara Y, lonescu LG. Micellar effects on the reactions of 2,4-dinitrophenyl phosphate and ethyl p-nitrophenyl phosphate with amines. J Org Chem. 1975 40 2313-2317. 

Synonyms AI3-17798 BRN 2542580 Caswell No. 454 EINECS 218-276-8 ENT 17298 EPA pesticide chemical code 041801 EPN 300 ESA Ethoxy-4-nitrophenoxy phenylphosphine sulfide Ethyl p-nitrophenyl benzenethionophosphate Ethyl p-nitrophenyl benzenethio-phosphonate Ethyl p-nitrophenyl ester 0-Ethyl 0-4-nitrophenyl phenylphosphonothioate Ethyl jD-nitrophenyl phenylphosphonothioate 0-Ethyl 0-p-nitrophenyl phenylphosphonothioate Ethyl p-nitrophenyl thionobenzenephosphate Ethyl p-nitrophenyl thionobenzenephosphonate 0-Ethyl phenyl p-nitrophenyl phenylphosphorothioate Ethyl p-nitrophenyl thionobenzene phosphate 0-Ethyl phenyl p-nitrophenyl thiophosphonate MAPJ Meidon dust 15 NSC 8943 NSC 404840 OMS 219 Phenylphosphonothioic acid O ethyl O-p nitrophenyl ester Phosphonothioic acid, 0,0-diethyl 0-(3,5,6-trichloro-2-pyridinyl) ester PIN Santox. 

Detection reagent (substrate) for enzyme-labeled antibody 2,2-azino-di(3-ethyl-benzthiazohne sulfonate-6) (ABTS) 0.3 g/L in 0.15 M sodium citrate with 0.1% H2O2 for the detection of horseradish peroxidase-labeled secondary antibody or p-nitrophenyl phosphate (pNPP) 1 g/L in 1M diethanolamine in water for the detection of an alkaline phosphatase-labeled antibody (Kirkegaard and Perry Laboratories). 

Substrate products can be classified as either soluble or precipitating. Soluble peroxidase substrates include o-phenylenediamine, which is converted into a yellow product 2,2 -azino-(3-ethyl)-benzothiazoline-sulfonic acid, which is converted into a green product and tetramethylbenzidine, which is converted into a blue product. Precipitating substrates for peroxidase include 4-chloronaphthol, which yields a blue precipitate and aminoethylcarbizole, which forms a red precipitate. Alkaline phosphatase is most frequently used with p-nitrophenyl phosphate to give a yellow-orange soluble product, or with 5-bromo-4-chloro-3-indo-lyl-phosphate p-toluidine salt to yield an insoluble blue product. 

In a kinetic study of the reactions of a series of hydroxamates, RCONHO-, with ethyl p-nitrophenyl ethylphosphonate (67 R = Et) and diethyl 4-nitrophenyl phosphate (67 R = OEt), their known typical a-nucleophile reactivities were in evidence, but anomalously high nucleophilicity was observed for anions possessing substituents... 

Diethyl p-nitrophenyl phosphate (DNPP) N-acetyl-1 tryptophan ethyl ester (NATrpEE) Sugatani et. al. 1987... 

Diethyl S-(2-(ethylthio)ethyl) phosphorodithloate Diethyl-p-nitrophenyl phosphate 0,0-Diethyl 0-pyrazinyl phosphoro-thioate... 

The phosphodiester complexes (ethyl 4-nitrophenyl phosphate )pentaam-mineiridium(III) and bis(4-nitrophenyl phosphate )pentaammineiridium(III) have also been prepared and their reactivities under basic conditions studied. Both complexes react predominantly via intramolecular attack of a deprotonated coordinated ammonia to liberate 4-nitrophenolate ion. The four-membered phosphoramidate chelate ring thus formed rapidly ring-opens, probably via P—O and P—N rupture, to yield N—bonded phosphoramidate monoester and O—bonded phosphate ester complexes. The rate constant... 

Zakharova et al." have studied the effects of mixed CTABr/Brij 97 (where Brij 97 = CigH35(OCH2CH2)ioOH) micelles on the rate of hydroxide ion-catalyzed hydrolysis of ethyl p-nitrophenyl chloromethyl phosphate, and the plots of experimentally determined pseudo-first-order rate constants (k s) against total mixed surfactant concentration, [Sjj (= [CTABrj + [Brij 97]x) at a constant molar fraction, Xcta = [CTABr]x/([CTABr]x + [Brij 97]x), reveal maxima at Xcta 0.17. These observed data have been satisfactorily explained by Equation 3.11... 

The O-dealkylation of organophosphorus triesters differs from the above reactions in that it involves the dealkylation of an ester rather than an ether. The reaction was first described for the insecticide chlorfenvinphos (Figure 10.2B), but is now known to occur with a wide variety of vinyl, phenyl, phenylvinyl, and naphthyl phosphates and the thionophosphate triesters. At least one phosphonate, O-ethyl O-p-nitrophenyl phenylphosphonate (EPNO), is also metabolized by this mechanism. 

Relative reactivity of imidazole and monohydrogen phosphate tfimidazolel/iKHPOj") is order of unity for general base catalysis, but about 10 for nucleophilic catalysis This ratio is 0,25 for ethyl acetate hydrolysis and 4.7 x I0 for p-nitrophenyl acetate hydrolysis 92... 

Fig. 16. Plot of nuoleophilio reactivity to various substrates vs. nucleophilic reactivity towards p-nitrophenyl acetate. Rate units are in M-l min-i. Symbols As , arsenate GEE, glycine ethyl ester gly, glycine glygly, glyoylglycine Iro, imidazole Melm, N-methylimidazole M or morph, morpholine Pi , phosphate, Piv, pivalate Pic, 4-picoline Py, pyridine pip, piperidine. Data taken from Bender and Glasson, (1959) Bruice and Willis (1965) Bruice and Benkovic (1964) Bruice and Mayahi (1960) Jencks and Carriuolo (1969) Jencks and Carriuolo (1960b) Di Sabato and Jeneks (1961a) Wolfenden and Jencks (1961) Johnson et al. (1966) Kirsch and Jencks (1964a) Butler and Gold (1961a), Reforonces for p-nitrophenyl acetate are in Table 8.

Morrow and Trogler (109) have studied the hydrolysis of two phosphate diesters by [Cu(bipy)] (bipy = 2,2 -bipyridine) in aqueous solution at 75°C in the pH range 5.8-8.3. For both bis(4-nitrophenyl)phosphate and ethyl-4-nitrophenylphosphate the reaction was proposed to proceed via coordination of the diester to the [Cu(bipy)] moiety followed by attack of a cis coordinated OH ion at the P center. Maximal rate enhancements of 1(P- to- 10 -fold were reported. The reaction was accompanied by incorporation of a single label in the product ethylphosphate when the reaction was conducted in labeled water. Saturation kinetics were observed for the hydrolysis of ENPP (ethyl-4-nitrophenylphosphate). The reaction obeyed Michaelis-Menton kinetics with a for the ENPP ion of... 

The po.ssibility that OPs can be designed as selective immunosuppressors for therapeutic purposes has been considered (Becker, 1975). It was theorized that highly specific, highly active, relatively stable, and nontoxic chemicals can be prepared. Specificity against the first component of the complement system was selectively increased by adding a terminal amino group to the p-nitrophenyl ethyl pentyl phosphate. It is. sometimes possible to separate the anticholinesterase activity from the protease inhibitor activity however, this approach has had limited success. 

Phosphoric acid esters Ethyl metaphosphate Phosphate buffer Quinoline phosphate Dichloro phosphites, CH OPCh Triethyl phosphate. Butyl phosphate Phenyl acid phosphate Diphenyl hydrogen phosphate Di-p-nitrophenyl hydrogen phosphate (RO)gPS... 

The simplest example of a functional micelle is (49), previously demonstrated to be more effective than its trimethylammonium analogue in both esterolysis and bimolecular elimination reactions. It has now been demonstrated that micelles of (49) are more effective catalysts for the hydrolysis of p-nitrobenzoyl phosphate dianion at high pH than non-functional surfactants. " 2,4-Dinitrochloro- and fluoro-benzene react with micelles of (49) at high pH 10" times faster than with hydroxide ion at a comparable external pH. The initial product is (50) and this in turn is hydrolysed in micelles 2.6 x 10 times faster than is 2,4-dinitrophenyl 2-(trimethylammonium)ethyl ether in water at pH 12. Acyl transfer between p-nitrophenyl acetate and (49) gives an intermediate whose hydrolysis is not micelle catalysed. In contrast to the rate acceleration observed in that case, hydrolysis of p-nitrophenyl acetate is inhibited by micelles of (51) since the phenoxide nucleophile is weak and at the reaction pH its micelles are zwitterionic, not cationic. Synthesis of functional choline-type micelles is facilitated by the use of sulphonate (52), which is reactive towards thiophenoxide in aqueous micelles, but its water-insoluble trifluoromethanesulphonate reacts with a range of anions under phase-transfer conditions. " ... 

The aminolysis of 0,0-diethyl 4-nitrophenyl phosphate (Paraoxon) by piperidine in 10 ILs was compared to results in MeCN, dioxane, and DMSO. Generally, rates and selec-tivities in the ILs were similar to those in DMSO. P NMR analysis of the aminolysis products in the ILs showed that piperidine attacked P=0 (5n2(P)), the C( 1) aromatic carbon ( nAt) and the ethyl group (5 2(0)), the latter pathway not having been observed previously. A theoretical study of the effect of sulfur substitution on the methanolysis... 

Theoretical studies of the hydrolysis of methyl phosphate anion have found that the dissociative mechanism involving the formation of metaphosphate is favoured over the associative mechanism involving a pentacoordinated intermediate.Phytic acid, myo-inositol hexakis(dihydrogen phosphate) (127), was completely hydrolysed to inositol in an aqueous polybasic alcohol at 150 °C a reaction mechanism was proposed. The reactions of p-nitrophenyl diethyl phosphate (128) and ethyl p-niuophenyl ethylphosphonate (129) with a wide range of oximate ions (p/(a = 7-13) in 10% aqueous ethanol at 25 °C have been studied. For oximate ions with p a 9.0, the reactivity of the oximes tends towards that of alcoholate ions and their Q -effect disappears (as had been previously shown with / -niuophenyl acetate). The reason for this is the unfavourable solvation effects of the solvent. A review (253 references) has appeared on the synthesis and reaction of Q -aminophosphonates. ° ... 

The synthesis of the two diastereoisomers of P -l-(2-nitrophenyl)ethyl adenosine S -lri-phosphate (91) has been achieved using resolved (R)- and (5)-l-(2-nilroidienyl)ethanol. The alcohols were converted to (R)- and (5)-l-(2-nitrophenyl)ethyl phosphates by phosphitylation with N,)V-diisopropyl-fi(s-(2-cyanoethyl)phosphoramidite (92) and subsequent oxidation with 3-chlorobenzoic acid. Each of the monophosphates was activated with carbonyidiimidazole and condensed with adenosine diphosphate to give the desired triphosphate. These ATP analogues can be used for the rapid release (by flash photolysis) of ATP in biological systems. The 8-azido-3 -0-anthraniloyl derivatives of 2 -dADP (93) and 2 -dATP (94) have been prepared in seven steps from 8-azido-2 -deoxyadenosine. These compounds are of interest as fluorescent and photoactivatable probes for the nucleotide binding site of kinases and cyclases. In particular, (94) was shown to be a competitive inhibitor of Bordetella pertussis adenylate cyclase and the observed K- (74 pM) was close to tiiat predicted from the K- value of 3 -0-anthraniloyl-2 -dATP. ... 

Walker, J. W., Reid, G. P., McCray, J. A. Trentham, D. R. (1988). Photolabile l-(2-nitrophenyl)ethyl phosphate esters of adenine nucleotide analogues. Synthesis and mechanism of photolysis. Journal of the American Chemical Society, 110, 7170-7. 

The report of the release of ATP by this method appeared in a 1978 rate study reported by Kaplan and co-workers. Inorganic phosphate (P ) and ATP were released from their l-(2-nitrophenyl)ethyl (NPE) and 2-nitrobenzyl (NB) esters, respectively ... 

---