Foamy virus

Park J, Nadeau P, Zucah JR, Johnson CM, Mergia A (2005) Inhibition of simian immunodeficiency virus by foamy virus vectors expressing siRNAs. Virology 343 275-282... 

Human foamy virus Causes foamy vacuolation in infected cells little is known of its occurrence or pathogenic potential... 

Oncoretroviruses are simple viruses encoding only the structural genes gag, pol, and env, whereas lentiviruses and spumaviruses have a more complex organization and encode for additional viral proteins (Figure 2). Lentiviruses encode three to six additional viral proteins that are essential for vims replication and persistence of infection. Two of the accessory proteins, tat and rev, are present in all lentiviruses and mediate transactivation of viral transcription (31,32) and nuclear export of unspliced viral RNA, respectively (33). Spumaviruses, also called foamy viruses (FV), contain, in addition to the structural proteins, three ORFs (taslbell, bel-2, and bel-3), of which taslbell has been identified as a coactivator of viral transcription (34). 

Rethwilm A, Erlwein O, Baunach G, Maurer B, ter Meulen V. 1991. The transcriptional transactivator of human foamy virus maps to the bel 1 genomic region. Proc. Natl. Acad Sci. USA 88 941 45... 

Heinkelein M, Schmidt M, Fischer N, Moebes A, Lindemann D, et al. 1998. Characterization of a cA-acting sequence in the Pol region required to transfer human foamy virus vectors. J. Virol. 72 6307-14... 

Erlwein O, Bieniasz PD, McClure MO. 1998. Sequences in pol are required to transfer of human foamy virus-based vectors. J. Virol. 72 5510-16... 

Moebes A, Enssle J, Bieniasz PD, Hein-kelein M, Lindemann D, et al. 1997. Human foamy virus reverse transcription that occurs late in the viral replication cycle. J. Virol. 71 7305-11... 

Yu SF, Baldwin DN, Gwynn SR, Yenda-palli S, Linial ML. 1996. Human foamy virus replication a pathway distinct from that of retroviruses and hepadnaviruses. Science 271 1579-82... 

Mergia A, Chari S, Kolson DL, Goode-now MM, Ciccarone T. 2001. The efficiency of simian foamy virus vector type-... 

Russelln RA, Wiegand HK, Moore MD, Schafer A, Me Clure MC, Cullen BP. Foamy virus Bet proteins function as novel inhibitors of the APOBEC3 family of innate antiretroviral defense. J Virol. 2005 79 8724-31. 

Spumavirus (the foamy viruses) Lentivirus (human, feline, simian, and bovine immunodeficiency viruses). Enveloped, spherical, negative-sense, and ssRNA (two identical strands). Synthesis occurs in the host cell cytoplasm maturation involves budding through the host cell plasma membrane. These viruses contain the enzyme reverse transcriptase. The retroviruses (except the Spumavirus and Lentivirus genera) represent the RNA tiunor viruses, causing leukemias, carcinomas, and sarcomas. 

P-labeled on 5 of ss DNA of 30 bases, (CATGGCAAAGCCAGTATACA AATTGTAATA), corresponding to the human foamy virus proviral DNA in the position of nucleotide 3643-3611, was incubated in a Tris buffer (pH 7.4) at 37 °C and ionic strength 0.02 (KCl) in the presence of polymers 33-36. Autoradiograms of acrylamide gel electrophoretic analysis of the reaction mixtures are shown in Fig. 16. No DNA cleavage occurred in the buffer or in the presence of 36, while polymers 33-35 catalyzed hydrolysis of DNA, as was observed in the hydrolysis of ethyl p-nitrophenyl phosphate substrate [99, 100]. 

Spumavirus Human foamy virus gpl30, gp48... 

Retroviruses carry the genetic material in the form of RNA rather than DNA. They infect only dividing cells and, therefore, cannot be used for transfecting post-mitotic neurons. However, the foamy viruses (TVs), a subfamily of retroviruses, appear to be suitable for transfection of neurons and other non-dividing cells [5]. The maximum length of the RNA fragment that can be inserted in a retrovirus is 8,000 base pairs (bp). 

Zhang Y, Liu Y, Zhu G et al (2010) Foamy virus an available vector for gene transfer in neural cells and other nondividing cells. J Neurovirol 16 419-426... 

---