Tangential ultrafiltration

Francioso, O., Sanchez-Cortes, S, Casarini, D., Garcia-Ramos, J. V., Ciavatta, C., and Gessa, C. (2002). Spectroscopy study of humic acids fractionated by means of tangential ultrafiltration./. Mol. Struct. 609,137-147. 

Filterable organic phosphorus isolated from several sites in and adjacent to the ENR were analysed by this method, using off-line phosphorus-specific mass spectrometry detection. The organic phosphorus was isolated and concentrated by tangential ultrafiltration and lyophilization to produce concentration factors of —25 and final total organic phosphorus concentrations of —1 mg P/1. Column effluent was collected in 1 ml fractions after ultraviolet detection at 214 nm. The chromatographic fractions, along with a matrix blank and 1 and 10 mg/1... 

Tangential ultrafiltration on membranes with a cutoff at 50000 Da does not eliminate unstable proteins from wine. In fact, a cutoff threshold on the order of 10000 Da (Hsu and Heatherbell, 1987b) is necessary to ensure protein stability in the permeate. However, membranes this fine cause a deterioration in the aromatic qualities of the wines, probably due to the elimination of macromolecules (Feuillat et al., 1987). 

A distinction is made between tangential ultrafiltration (pore diameter of 0.1-0.001 (im) and... 

Peuravuori, J. et al.. Comparative study for separation of aquatic humic-type organic constituents by DAX-8, PVP and DEAE sorbing solids and tangential ultrafiltration elemental composition,... 

Solvent Elimination (Tangential Ultrafiltration, Vacuum evaporation. Magnetic Agitation)... 

Tangential crossflow filtration Process where the feed stream sweeps the membrane surface and the particulate debris is expelled, thus extending filter life. The filtrate flows through the membrane. Most commonly used in the separation of high-and-low-molecular weight matter such as in ultrapure reverse osmosis, ultrafiltration, and submicron microfiltration processes. 

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

There are several other techniques that can be used to perform group fractionation. These include dialysis, ultrafiltration, ultracentrifugation, tangential... 

To aid in the characterization of the DOM pool, marine organic chemists have developed techniques fiar separating compounds into size fractions. Tangential flow ultrafiltration is used to isolate a high-molecular-weight (HMW) fraction from a low-molecular-weight (LMW) fraction. The size cutoff between these is approximately 1 tun, which equates... 

Tangential-flow ultrafiltration was used with approximately 150-L samples of centrifugate from the ship-based centrifuges. 

Relatively few biochemicals can be measured directly in natural waters because concentrations of individual compounds are low (nanomolar) and salts and other components often interfere with these analyses. DOM can be concentrated and isolated from natural waters for more thorough chemical characterization, and two approaches for DOM isolation, adsorption onto solid phases and ultrafiltration are now widely used. The adsorption of DOM onto XAD resins is used to isolate a fraction of DOM that is operationally defined as humic substances (Thurman, 1985). More recently, tangential-flow ultrafiltration with 1000 Da cutoff membranes has been used to isolate the high-molecular-weight or colloidal fraction of DOM (Benner et al., 1992, 1997). 

Humic substances account for 40-70% of the DOC in rivers and 5-25% of the DOC in the ocean (Table I). It is important to note that recoveries of adsorbed humic substances from XAD resins are not quantitative, so the chemical characteristics of the recovered humic substances are not necessarily representative of all the humic substances retained by the resin. Tangential-flow ultrafiltration retains 45-80% of the DOC in rivers and 25-40% of the DOC in the surface ocean (Table I). Essentially all of the DOC retained during ultrafiltration is recovered for chemical characterization. In general, ultrafiltration recovers a larger fraction of the DOM from these systems. These methods also isolate DOM based on different mechanisms. Adsorption onto XAD resins at low pH chemically fractionates the DOM and isolates the more hydrophobic components, whereas ultrafiltration principally separates components of DOM on the basis of size and shape. 

Benner, R., B. Biddanda, B. Black, and M. McCarthy. 1997. Abundance, distribution, and stable carbon and nitrogen isotopic compositions of marine organic matter isolated by tangential-flow ultrafiltration. Marine Chemistry 57 243—263. 

H NMR spectra have been used to analyze 11 DOM samples that were isolated from seawater using tangential-flow ultrafiltration and one sample that was isolated using dialysis (Aluwihare et al., 1997). A linear combination of three endmembers (carbohydrates, lipids, and acetate) was sufficient to account in some detail for the... 

One approach to delivering increased performance in a membrane process is to complement one separation mechanism with another. Vapor-arbitrated pervaporation is an example of this strategy. In bioseparations, as will be covered in a later section, a similar integration of several process enhancements in High-Performance Tangential How Filtration is responsible for dramatic improvement in separation efficiency of protein mixtures once considered unachievable by means of conventional ultrafiltration. 

Ultrafiltration was applied to examine the size fractionation of Al, Ca, Cu, Fe, K, Na, and Pb in white and red wines [91]. Metal determinations were performed on the unfiltered wine, the 0.45 p,m membrane-filtered wine and each ultrafiltrate fraction. Aluminum was determined by ET-AAS, while FAAS was employed for Cu and Fe. An electroanalytical technique, stripping potentiometry, was selected for Pb measurement, whereas flame photometry was chosen for K and Na quantification. Fractionation patterns were evaluated and discussed. Castineira et al. [92] combined on-line tangential-flow multistage ultrafiltration with a home-built carbon analyzer and ICP-MS for size fractionation of nonvolatile dissolved organic compounds and metal species in three German white wines. The study showed that the major part of the elements investigated (up to 25) were dissolved in the size fraction of < 1 kDa, with the exception of Ba, Pb, and Sr, which also appeared in other fractions. 

M. M. Castineira, P. Burba, N. Jakubowski, J. Andersson, Size fractionation of nonvolatile dissolved organic compounds and metal species in German white wines by combining on-line tangential-flow multistage ultrafiltration, a home-built carbon analyzer, and inductively coupled plasma mass spectrometry, Anal. Bioanal. Chem., 376 (2003), 174-181. 

The difference between conventional dead-end filtration and cross-flow filtration is the configuration of the system. For large-scale operations, only cross-flow filtration will be used. The membranes for miocrofiltration as well as ultrafiltration are commonly utilized in a variety of filtration devices. There are three basic types of tangential flow filtration devices plate and frame, hollow fiber, and spiral wound membranes. 

---