Protein expression and purification

Electrocompetent Escherichia coli XL-1 Blue and BL-21 (DE3) were used for plasmid synthesis and protein synthesis respectively. Aliquots (100 p,L) of electrocompetent cells were thawed on ice, and 20-100 ng of plasmid was added and mixed. Cells were kept on ice for 5 min before transferring to an electroporation cuvette, where an electrical pulse is applied to the cells. Immediately following electroporation, cells were transferred to 9(X) p L of LB medium and incubated at 37 °C with agitation for 1 h. Typically, 1(X) pL of cells were then plated onto LA plates enriched with the appropriate antibiotic (30 pg/mL Kanamycin or Chloramphenicol). Plates were incubated overnight at 37 °C, with transformation of the cells confirmed by presence of colonies, which were picked and grown for plasmid synthesis (XL-1 Blue) or protein synthesis (BL-21 (DE3)). 

Protein-containing fractions were pooled and concentrated using a Viva-Spin centrifugal concentrator at an appropriate MWCO (5 kDa for ACP, 30 kDa for KS). Addition of 10 % glycerol (v/v) to the resulting concentrate of pure protein allowed snap-freezing in liquid N2, followed by storage at —80 °C (Fig. 2.2). 

BaeJ KSl (N206A), (M268A), (L450A) and BaeL KS5 (M237A) 

KSKC207A) KS1C207A For (5 - CTATTTTGTCCACGCCAACGC CTCATCTTCGTTAATCGGC-3 ) KS1C207A Rev (5 - GCCGATTAACGAAGATGAGfi GTTGGCGTGGACAAAATAG-3 ) AAC GCA (Cys Ala) 

PedD(R97A) PedDR97Q For (5 - CTGAGACTCGTGCAGAAGCAG GGTGATCTGATGAGTCAGG-3 ) PedDR97Q Rev (5 - CCTGACTCATCAGATCACCCT GCTTCTGCACGAGTCTCAG-3 ) CGT CAG (Arg Gin) 

---

Deschamps, J. R., Miller, C. E., and Ward, K. B. (1995). Rapid purification of recombinant green fluorescent protein using the hydrophobic properties of an HPLC size-exclusion column. Protein Expression and Purification 6 555-558. 

Inouye, S., Zenno, S., Sakaki, Y., and Tsuji, F. I. (1991). High-level expression and purification of apoaequorin. Protein Expression and Purification 2 122-126. 

Li, L. (2000). Gonyaulax luciferase gene structure, protein expression, and purification from recombinant sources. Method. Enzymol. 305 249-258. 

Masuda, H., et al. (2003). Chromatography of isoforms of recombinant apoaequorin and method for the preparation of aequorin. Protein Expression and Purification 31 181-187. 

Shimomura, O., and Inouye, S. (1999). The in situ regeneration and extraction of recombinant aequorin from Escherichia coli cells and the purification of extracted aequorin. Protein Expression and Purification 16 91-95. 

Hartley, J.L. (2006) Cloning technologies for protein expression and purification. Current Opinion in Biotechnology, 17 (4), 359-366. 

Lin, C.T., Moore, P.A., Auberry, D.L. et al. (2006) Automated purification of recombinant proteins combining high-throughput with high yield. Protein Expression and Purification, 47 (1), 16-24. 

Hasslacher, M., Schall, M., Hayn, M. et al. (1997) High-level intracellular expression of hydroxynitrile lyase from the tropical rubber tree Hevea brasiliensis in microbial hosts. Protein Expression and Purification, 11, 61-71. 

The third time constraint depends on whether the product can be extracted from seeds or fruits. This uncouples protein expression and purification. Large batches of seeds containing the recombinant protein can be produced and stored at low costs. Provided the protein remains stable in the stored seeds, purification can be carried out on demand or shifted according to free capacities. The advantage of one large harvest, with seeds mixed to uniformity, is that this allows production on demand. In contrast, mammalian cell culture is prone to minor batch-to-batch variations in... 

Lesley, S. 2001. High-throughput proteomics protein expression and purification in the post-genomic world. Protein Expression and Purification 22(2), 159-164. 

Bansal, V. and Roychoudhury, P. 2006. Production and purification of urokinase a comprehensive review. Protein Expression and Purification 45(1), 1-14. 

Hasslacher M, Schall M, Hayn M, Bona R, Rumbold K, Liickl J, Griengl H, Kohlwein SD, Schwab H (1997) Protein Expression and Purif 11 61... 

Stols, L., Gu, M., Dieckman, L., Raffen, R., Collart, F., and Donnelly, M. (2002) A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch vims protease cleavage site. Protein Expression and Purification 25,8-15. 

Protein expression and purification have traditionally been time-consuming, case-specific endeavors, and are considered to be the greatest bottlenecks in most proteomics pipelines (1) Escherichia coli (E. coli) is the most convenient and cost-effective host, although optimal conditions for the expression of different proteins vary widely. Proteins vary in their structural stability, solubility, and toxicity in this environment, resulting in differing rates of protein degradation,... 

Kim, J.E., Jeong, D.W., and Lee, H.J. 2007. Expression, purification, and characterization of arginine deiminase from Lactococcus lactis ssp. lactis ATCC 7962 in Escherichia coli BL21. Protein Expression and Purification 53 9-15. 

A. D. Keefe et al. One-step purification of recombinant proteins using a nanomolar-affinity streptavidin-binding peptide, the SBP-Tag. Protein Expression and Purification, 23 (2001), 440-6. 

---