Ultrafiltration desalting

Fig. 17.9. Purity comparison (SDS-PAGE) of the conventional purification process and integrated cell disrupt tion/fluidised bed adsorption.The numbers given in the flow sheet indicate the origin of samples and correspond to their respective lane numbers. Lanes M, low molecular weight markers 1, Erwinia disruptate, 15% biomass ww/v 2, eluate CM HyperD LS, fluidised bed 3, desalted eluate (after dia/ultrafiltration, 30 K MWCO membrane) 4, flow-through, DEAE fixed bed 5, elution, DEAE fixed bed 6, eluate CM HyperD LS 7, CM cellulose eluate 8, CM cellulose eluate, final 9, final commercial product.

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

Purify the derivatized dendrimer using gel filtration (size exclusion chromatography) on a desalting column or through use of ultrafiltration spin-tubes (for G-4 and above). For smaller dendrimers, the derivatives may be purified by repeated precipitation from a meth-anolic solution by addition of ethyl acetate, dioxane, or benzene. The SPDP-dendrimer may be dried by lyophilization (if in water or buffer) or by solvent evaporation in vacuo (if the precipitation method was used). 

Purify the biotin-dendrimer using size exclusion chromatography on a desalting matrix or by use of ultrafiltration (e.g., centrifugal concentrators). 

Desalting is also possible by ultrafiltration. For this purpose, the sample is concentrated to about 10% of its volume, reconstituted to its original volume with water or a second buffer, and ultrafiltration is repeated twice in the same way. Proteins are less likely to be denatured, because ultrafiltration is a mechanical separation which does not need harsh chemicals for separation. 

After ion exchange chromatography the enzyme preparation is in a more workable volume and is then ready for further purification. Depending on the requirement for the next step, the enzyme solution can be desalted by gel filtration or ultrafiltration or the buffer can be changed by diafiltration. 

Reverse osmosis is essentially the same process as ultrafiltration with low salt rejection. Kopfler and co-workers (12) used reverse osmosis in combination with solvent extraction and XAD adsorption. Solvent extraction with pentane and methylene chloride was used to remove organics from the reverse-osmosis concentrate (i.e., for desalting), and XAD was used for adsorption of the intractables from the extracted... 

In the dairy industry the high content of minerals in cow milk (Table IX) restricts the commercial utilization of its main by-products, that is, whey and ultrafiltration permeates. The discovery that desalted whey could be used in baby food production as an economic alternative to the more expensive skim... 

Depending on the enrichment term (E0) of the membrane, the modulus can be larger or smaller than 1.0. For reverse osmosis E0 is less than 1.0, and the concentration polarization modulus is normally between 1.1 and 1.5 that is, the concentration of salt at the membrane surface is 1.1 to 1.5 times larger than it would be in the absence of concentration polarization. The salt leakage through the membrane and the osmotic pressure that must be overcome to produce a flow of water are increased proportionately. Fortunately, modem reverse osmosis membranes are extremely selective and permeable, and can still produce useful desalted water under these conditions. In other membrane processes, such as pervaporation or ultrafiltration, the concentration polarization modulus may be as large as 5 to 10 or as small as 0.2 to 0.1, and may seriously affect the performance of the membrane. 

Lorain, O., B. Hersant, F. Persin, A. Grasmick, N. Brunard, and J. M. Espenan. 2007. Ultrafiltration membrane pre-treatment benefits for reverse osmosis process in seawater desalting. Quantification in terms of capital investment cost and operating cost reduction. Desalination 203 277-285. 

One of the drawbacks of ion exchange chromatography is the need for a secondary technique to remove inorganic salts from the purified product. Desalting can often be performed by ultrafiltration, solid phase extraction or by gel filtration. The latter mode of separation is described briefly in Section 3.5. 

Desalting techniques include ultrafiltration, which simultaneously desalts and concentrates the sample membrane dialysis (Cooksy, 1992) and simple dilution in low ionic strength buffer or water. The latter method is especially useful when glycerol, Triton X-100, or formamide has been added to the PCR mixture. It should be noted that loss of DNA from adsorption onto the filters in ultrafiltration has been reported (Butler et al., 1994). Thus, as a rule, sample desalting by this method should be used as a last resort. 

The most widely used nominal pore size for ultrafiltration is 1 nm, which is estimated to retain compounds with MWs >1000 Da. The 1 nm pore-sized membrane isolates 20% of the total DOC in surface and deep ocean waters and up to 55% of the DOC in coastal and estuarine environments (Benner et ai, 1997 Carlson et ah, 1985 Guo and Santschi, 1996). Ultrafiltration membranes with a smaller pore size are rare and do not show reproducible retention characteristics filters with a larger pore size retain only a small fraction of total DOC and they are not widely used. In general, the actual MW retained and the isolation of reproducible quantities of DOC by ultrafiltration depends strongly on the membrane (e.g. construction material, manufacturer), sample type (e.g. river, coastal, open ocean), total DOC concentration, concentration factor, extent of desalting and operating conditions (Buesseler et al, 1996 Guo and Santschi, 1996 Guo et ai, 2000). Losses to the ultrafiltration membrane can also be significant (Guo et al., 2000) and depend primarily on the physiochemical characteristics of the particular molecule. 

A holy grail for DON (and DOM in general) remains a rapid and portable method to quantitatively isolate and desalt a large dissolved sample (Bronk, 2002). Such a method would not only allow a wealth of diverse techniques to be brought to bear on the largest unknown fraction of DON, but would allow direct isotopic measurements and compound-specific mass balances. Examples of some approaches currently being explored to improve DON recovery on both small and large scales include homemade ion-retardation resins (Bronk, unpublished data), electrodialysis (Vetter et al, 2007), and use of nano-filtration membranes coupled to standard ultrafiltration approaches (McCarthy et al unpubhshed data). 

Polyelectrolyte complexes are very promising materials for preparing semi-permeable membranes of definite permeability and selectivity The methods of preparation and the properties of membranes made of polyelectrolyte complexes based on strong polyelectrolytes, e.g. poly(sodium sterene sulfonate) and poly(vinylbenzyl-trimethyl ammonium chloride) were described These membranes may be applied for reverse osmosis in the desalting of sea-water, for dialysis and ultrafiltration in purifications and concentration of water solutions containing coUoids or micro-and macroparticles ... 

---