Trichoderma harzianum

Dandurand L M, Mosher R D and Knudsen G R (2000), Combined effects of Brassica napus seed meal and Trichoderma harzianum on two soilbome plant pathogens , Can... 

Sivan, A. and Chet, I. (1989). Degradation of fungal cell walls by Litic enzymes of Trichoderma harzianum , Journal of Genetic Microbiology, 135, 675-682. 

Otieno W, Termorshuizen A, Jeger M, Otieno C (2003) Efficacy of soil solarization, Trichoderma harzianum and coffee pulp amendment against Armillaria sp. Crop Prot 22 325-331. doi 10.1016/S0261-2194(02)00174-6... 

Fig. 2.139. Upper lane densitograms of colour pigments of Trichoderma harzianum. Alugram RP-I8W/UV254 plates. Gradient water-acetone (10 90, v/v) for 3cm water-acetone (45 55, v/v) for 13cm. Detection wavelength 400 nm. Lower lane RP-HPLC chromatogram of colour pigments of Trichoderma harzianum. Reprinted with permission from G. Csiktusnadi Kiss et al. [312].

Fig. 1. Trichoderma harzianum colony forms ring structures on potato-dextrose agar white feeding mycelium (right) and green sporulating mycelium (left).

Figure 2. Interactions between Clostridium butyricum and Trichoderma harzianum. VFAs = volatile fatty acids. Source Reproduced with permission from Ref. 12. 1985, D. A. Veal.

Figure 1. Induction of xylanases in Trichoderma harzianum. The ratios of xylanase to endocellulase activities were determined in the culture filtrates of T. harzianum grown on steam treated aspenwood. Aspen chips were steam treated from 20 to 240 s at 240° C to produce a series of samples with a variable content of xylan and cellulose. The specific content of these carbohydrates were expressed as the ratio of xylan to glucan. Enzyme activities were determined on culture filtrates of 300 mL batch cultures of T. harzianum grown on these wood samples at a loading of 1% (w/v) as described by Saddler and Mes-Hartree (66). Enzyme activities were also determined in culture filtrates of T. harzianum grown on Avicel, Solka Floe and oat spelts xylan.

Many examples of the purification of xylanase enzymes to homogeneity can be found in the reviews of Dekker and Richards (85), Woodward (86) and Reilly (87). Other xylanases which have been prepared recently to very high purity using traditional biochemical techniques include xylanases from Sporotrichum dimorphosporum (88) Streptomyces sp. (71) Trichoderma harzianum (5,55) Clostridium acetobuiylicum (30,89) mesophilic fungal strain Y-94 (80) Aspergillus nigcr (90-92) and several thermostable xylanases discussed above. 

Trichoderma harzianum biotypes 2 und 4 chrysophanol, koninginin A, trichorzianines A B RAPD marker PCR 444 Th-F Th-R CGGTGACATCTGAAAAGTCGTG TGTCACCCGTTCGGATCATCCG Chen et al., 1999... 

Chen, X., Romaine, C. P., Ospina-Giraldo, M. D., and Royse, D. J. (1999). A polymerase chain reaction-based test for the identification of Trichoderma harzianum biotypes 2 and 4, responsible for the worldwide green mold epidemic in cultivated Agaricus bisporus. Appl. Microbiol. Biotechnol. 52, 246-250. 

Gallo, A. (2004). Isolation and characterisation of a trichodiene synthase homologous gene in Trichoderma harzianum. Physiol. Mol. Plant Pathol. 65,11-29. 

Lee CH, Chung MC, Lee HJ, Bae KS, Kho YH (1997) MR566A and MR566B, New Melanin Synthesis Inhibitors Produced by Trichoderma harzianum I. Taxonomy, Fermentation, Isolation and Biological Activities. J Antibiot 50 469... 

Trichoderma harzianum Sponge Trichodenones, harzialactones spiroxins... 

Claydon, N., Allan, M., Hanson, J. R., Avent, A.G, Antifungal alkyl pyrones of Trichoderma harzianum. Trans Br Mycol Soc 1987 88 503-13. 

Green, H. Heiberg, N., Lejbolle, K., Jensen, D.F. The use of a GUS transformant of Trichoderma harzianum, strain T3a, to study metabolic activity in the spermosphere and rhizosphere related to biocontrol of Pythium damping-off and root rot. Eur J Plant Pathol 2001 107 349-359. 

Papavizas, G.C. Survival of Trichoderma harzianum in soil and in pea and bean rhizosphere. Phytopathology 1982 71 121-125. 

Dubourdieu, D., Desplanques, C., Villettaz, J. C., and Ribereau-Gayon, P. (1985). Investigations of an industrial B-glucanase from Trichoderma harzianum. Carbohydr. Res. 144, 277-287. 

Phenolic compounds Trickoderma viride Trichoderma harzianum Trichoderma pseudokoningii SSF Zheng and Shetty (2000a)... 

Moniliella suaveolens, Trichoderma harzianum, Pityrosporum ovale, and Ceratocytis moniliformis form decalactones (problems with phenolic components)... 

Seyis, I. and Aksoz, N. (2005). Xylanase production from Trichoderma harzianum 1073 D3 with alternative carbon source and nitrogen sources. Food Technol. Biotechnol. 43,37-40. 

Trichoderma harzianum and HB metals adsorption to mycelium and production of complexing metabohtes. Biometals, 6, 223-230. 

HC-Toxin and victorin are produced by Helminthosporium carborum, which is a pathogen on maize, whilst another peptide, AM-toxin, is produced by Alternaria alternata, which causes a blotch disease on apples. The peptabiols, produced by Trichoderma harzianum, affect the development of other fungi. 

Harzianolide (4.56) is an anti-fungal metabolite of Trichoderma harzianum. It contains a butenolide ring and labelling studies have suggested that it may be formed by a similar process. 

Chemistry of the biocontrol agent, Trichoderma harzianum, J.R. Hanson, Sci. Progr., 2005, 88, 237. 

Trichoderma harzianum Ulocladium chartarum Zalerion maritima... 

---