Satratoxin

Chung, Y. J. et al. Up-regulation of macrophage inflammatory protein-2 and complement 3A receptor by the trichothecenes deoxynivalenol and satratoxin G. Toxicology 186, 51, 2003. 

Yang, G. et al. Apoptosis induction by the satratoxins and other trichothecene mycotoxins Relationship to ERK, p38 MAPK and SAPK/JNK Activation. Toxicol. Appl. Pharmacol. 164, 149-160, 2000. 

S. chartarum satratoxin G H triS gene PCR 445 ScTox5-l ScTox5-4 GTCTATACTCGACAATAGTCC GTCCTTCTGAGAGAACACTA Peltola et al., 2002... 

S. chartarum Satratoxin G H triS gene PCR n.s. triSSl tri5S2 CCTCACCCTCAGATGTTGACATAC TCCTTGTAGAAGGACATGAGGTCA Koster et al., 2003... 

FIGURE 26.1. Chemical structure of trichothecene mycotoxins from group A, T-2 toxin group B, deoxynivalenol (DON) and group D (satratoxin H). From Haschek et al. (2002). 

Recent studies indicate that some trichothecenes can bind covalently. Satratoxin G, a macrocyclic trichothecene, forms covalent adducts with proteins and potentially other cellular macromolecules (Gregory et al, 2004 Yike et al, 2006). The ability of satratoxin G to bind to albumin provides a potential biomarker of exposure to the toxin as well as to Stachybotrys chartarum. 

Experimentally, the macrocyclic trichothecenes satra-toxin G, isosatratoxin F, and roridin A have been shown to cause nasal and pulmonary toxicity when administered intranasally or intratracheally to mice. Intranasal exposure of satratoxin G and roridin A induced apoptosis of olfactory sensory neurons resulting in atrophy of the olfactory epithelium and olfactory nerve layer of the olfactory bulb in the frontal brain (Islam et al, 2006, 2007). Alveolar-type II cells and alveolar macrophages were injured following intratracheal instillation of isosatratoxin F or Stachybotrys spores with marked changes in surfactant synthesis and secretion (Rand et al, 2002). 

Islam, Z., Harkema, J.R., Pestka, J.J. (2006). Satratoxin G from the black mold Stachybotrys chartarum evokes olfactory sensory neuron loss and inflammation in the murine nose and hxam. Environ. Health Perspect. 114 1099-1107. 

Trichothecene mycotoxins Stachybotrotoxins, including satratoxin H T-2 mycotoxins Marine toxins Phycotoxins (algal toxins)... 

Trichothecenes from Pusarium, Stachybotrys, and Trichoderma, among others. Note Trichothecenes include sesquiterpenes with a trichothecane skeleton, olefinic groups at C-9 and C-10, and epoxies at C-12 and C-13. Macrocyclic trichothecenes have a carbon chain between C-4 and C-15 in an ester or ether linkage (e.g., T-2 toxin, DON, satratoxins G and H verrucarins B and J, trichoverrins A and B)). 

Mycotoxins may include butanol, estrogenic compounds (e.g., zearalenone), heptanone, lactones, lactams (patulin), stachybotrylactones, stachybotry-lactams, 2-pentylfuran, 2-hexanone, 2-methyl-1-propanol, 3-methylfuran, 2-methylisoborneol, 3-methyl-2-butanol, and macrocyclic trichothecenes (Satratoxins F, G. and H, Roridine, Verrucarinj, and Trichoverrols). 

After discovery of T-2 toxin [3-Hydroxy-4, 15-diacetoxy- 8- (3-methyl-butyryloxy] -12,13-epoxy-trichothec-9-ene) as a causative agent of moldy com toxicoses in cows in the USA, dcoxynivalcnol (DON), nivalenol (NIV), satratoxins and other chemically related toxins were isolated. A survey carried out by Marasas et al. showed that a high incidence of esophageal cancer in Transkei of South Africa was associated with a high level of DON and zearalenone (ZEN). 

Macrocyclic trichothecenes such as Satratoxin also were identified as causative toxicants. Since the 19th century, Alimentary Toxic Aleukia (ATA) or septic angina has been reported in the Soviet Union and symptoms of the disease were described as necrotic angina, leukopenia, hemorrhage, and exhaustion of bone marrow and death. 

Stachybotryotoxicosis has been reported among farm workers in Russia, Yugoslavia, and Hungary.38,39 This disease is caused by the presence of a mold, Stachybotrys atra (S alternans), on the hay fed to domestic animals. A macrocyclic trichothecene (satratoxin) produced by the Stachybotrys species of the mold may be in part responsible for this toxicosis.40 The only literature citation on apparent human cases of stachybotryotoxicosis in the United States occurred in people living in a water-damaged house with a heavy infestation of S atra.41... 

R Macrocyclic ester or ester-ether bridge between carbons 4 and 15. The most abundant macrocyclic trichothecenes are verrucarins, roridins, and satratoxin H. Source for this statement Jarvis BB. Macrocyclic trichothecenes. In Sharma RP, Salunkhe DK, eds. Mycotoxins and Phytoalexins. Boca Raton, Fla CRC Press 1991 361-421. 

New trichothecane sesquiterpenoids include trichodermadiene (122), satratoxin F (123), and satratoxin G (124). ° An X-ray analysis has established the absolute configuration of verrucarin B (125). This result means that the... 

---