Optimization of PCR

Asymmetric PCR with the excess of the primer that is extended to aptamer candidates over the primer that is extended to complementary aptamer sequences has been used successfully in quick testing of affinity between rounds of SELEX. Asymmetric PCR is slower, but it allows us to avoid the strand separation procedure, as complementary strands are generated in small amounts and affect 

---

Qualitative optimization of PCR conditions and product characterization Quantitative ... 

Fig. 2. The effects of pig-tailing the amplification primers to maximize the Taq adenosine addition. The addition of an adenosine to the 3 end of amplicons that is not matched in the amplification template is shown to greatly increase the number of observed fragment species even after the optimization of PCR conditions in a sample heterozygous for a 2-bp repeat (A). The addition of the GTTTCT pig-tail to the 5 end of the reverse primer greatly increases the affinity of this addition reducing the number of observed fragments (B). Note the increase in overall fragment size of seven base pairs, which represents the 6-bp primer addition and the added adenosine.

Innis MA, Gelfand DH (1990) Optimization of PCRs. In Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR Protocols. Academic Press, NY, p 3... 

The amplification reaction is carried out in IX PCR buffer containing 100 yM dNTPs, 30 pmol of biotinylated primers, 10-100 ng of human template DNA, and 2 U of Taq polymerase. The PCR profile consists of an initial denaturation at 95°C for 5 min. The samples are then subjected to PCR with 30-s incubations at 94, 55, and 72 C for 35 cycles. See Note 3 for an alternative method of biotinylating PCR products. A lengthy discussion of optimization of PCR reactions is beyond the scope of this chapter, but further information can be found in Note 5 and references given therein. 

SEP without any index is mostly used for prediction errors obtained from a test set (for clarity better named SEPtest). SEPCv is calculated from prediction errors obtained in CV, for instance during optimization of the number of components in PLS or PCR. SEPcv is usually smaller (more optimistic) than SEPtest. If Equation 4.6 is applied to predictions of the calibration set, the result is called standard error of calibration (SEC) SEC is usually a too optimistic estimation of the prediction errors for new cases. 

Using the calibration set, a model is created in the case of PLS or PCR, additionally an optimization of the number of components has to be done—for instance by CV, or by an inner bootstrap within the calibration set. The resulting optimized model is then applied to the objects not contained in the calibration set giving predicted values... 

FIGURE 4.30 Results of PCR for the PAC data set. The black line results from a single 10-fold CV, the gray lines from repeating the 10-fold CV 100 times. Indicated is the optimal number of PCs as obtained by repeated double CV, see text. 

For optimization of the amplification reaction, repeat the amplification with up to 100 cycles. If there is still little or no product, you can use a second (normal) PCR seeded by an aliquot of the first PCR to increase the yield of the StEP reaction. 

In addition to successful linking of target antigen and DNA marker, as discussed in the previous chapter, the subsequent amplification of the DNA is the second key factor for efficient IPCR. Similar to many protocols developed for quantitative PCR [2], the DNA amplification product has to be converted into a detectable signal. Typically, a simple yes/no decision on the presence of the DNA marker is not sufficient, and a quantitative readout dependent on the antigen concentration is needed. Therefore, in many IPCR applications the cycle number in PCR-amplification is limited to the exponential phase of the amplification for example, 30 or fewer cycles [10, 24-26, 29, 31, 33, 37]. Alternatively, successful applications of 40 cycles were also reported [34-36, 38, 39, 41], underlining the relative flexibility of PCR conditions for the amplification step. The need for an optimized cycle number is only important for end point determinations such as gel electrophoresis (Section 2.2.1) or PCR-ELISA (Section 2.2.2). Recently, the... 

In an IPCR application developed by Furuya et al. [27], interleukin 18 (IL-18) was studied as an important protein in a number of immunological derangements. An indirect sandwich IPCR (Fig. 3D) was used for the detection of IL-18 in cell culture supernatants and serum samples. A quantitative study of low-level IL-18 was carried out beneath a serum concentration of typically 96 135 ng/L. In a systematic variation of assay conditions, the amount of biotinylated 227-bp DNA marker used in the Universal-IPCR protocol was identified as a source for nonspecific amplification. Following an optimization of DNA concentration and PCR cycle number, 2.5 pg/L IL-18 was detected. 

If the amplified PCR product is not the correct size, the PCR reaction must be optimized (components of PCR and reaction conditions). Deep Vent polymerase can be used, but both Taq and Vent polymerase frequently increase the error rate. 

It is beneficial to identify clones that contain the correct insert prior to plasmid purification and sequencing. The following protocol for colony PCR utilizes primers that anneal to the vector sequence, which is advantageous because one optimized set of PCR conditions is used. This allows for easy preparation, and avoids problems related to different primer conditions. In addition, a negative control of vector DNA can serve as a built-in control for the reaction. Primers should be chosen that produce a product of approx 100 bp when vector DNA without insert is amplified. To amplify the pNHis vector, the T7 promoter (5 TAATACGACTCACTATAGGG 3 ) and T7 terminator (5 GCTAGTTATT GCTCAGCGG 3 ) primers were used. 

Park, J.-W., M. Hecker, M.B. Murphy, P.D. Jones, K.R. Solomon, G. Van Der Kraak, J.A. Carr, E.E. Smith, L. Du Preez, R. J. Kendall, and J.P. Giesy (2006). Development and optimization of a Q-RT PCR method to quantify CYP19 mRNA expression in testis of male adult Xenopus laevis Comparisons with aromatase enzyme activity. Comp. Biochem. Physiol. B. 144 18-28. 

Eri.il, I., Campoy, S., Erill, N., Barbe, J., Aguilo, J., Biochemical analysis and optimization of inhibition and adsorption phenomena in glass-silicon PCR-chips. Sensors Actuators B 2003, 96, 685-692. 

---