Membrane desalting

Thymostimulin (TS) is an extract of calf thymus glands that has been partially purified by Falchetti et al. (1977) in Italy. Calf thymus tissue is first minced and extracted with ammonium acetate. This extract is then fractionated with ammonium sulfate precipitation. The 0-25% ammonium sulfate cut is further purified by ultrafiltration on an Amicon PM-10 membrane, desalted on Sephadex G-25, and gel filtered on Sephadex G-50. The biologically active preparation exhibits two predominant bands on polyacrylamide gels at pH 8.6. At the present time there have been no attempts to further define the constituents of this partially purified preparation. Although TS is similar to thymosin fraction 5 in its purification schema, a 0-25% ammonium sulfate precipitation step is used, whereas a 25-50% saturation fractionation cut is employed for the isolation of thymosin fraction 5. In addition, the purification procedure for TF5 includes an acetone precipitation step, whereas this procedure is not included in the preparation of TS. Thus, there... 

S.V. Cabibbo, D.B. Guy, A.C. Ammeralaan, A. Ko, R. Singh, Parametric study on brackish water membrane desalting plants, NWSIAJ,July (1979) 17-36. 

The fourth fully developed membrane process is electrodialysis, in which charged membranes are used to separate ions from aqueous solutions under the driving force of an electrical potential difference. The process utilizes an electrodialysis stack, built on the plate-and-frame principle, containing several hundred individual cells formed by a pair of anion- and cation-exchange membranes. The principal current appHcation of electrodialysis is the desalting of brackish groundwater. However, industrial use of the process in the food industry, for example to deionize cheese whey, is growing, as is its use in poUution-control appHcations. 

While the ambient-temperature operation of membrane processes reduces scaling, membranes are much more susceptible not only to minute amounts of scaling or even dirt, but also to the presence of certain salts and other compounds that reduce their ability to separate salt from water. To reduce corrosion, scaling, and other problems, the water to be desalted is pretreated. The pretreatment consists of filtration, and may include removal of air (deaeration), removal of CO2 (decarbonation), and selective removal of scale-forming salts (softening). It also includes the addition of chemicals that allow operation without scale deposition, or which retard scale deposition or cause the precipitation of scale which does not adhere to soHd surfaces, and that prevent foam formation during the desalination process. 

Fig. 13. A hoUow-fibet reverse osmosis membrane element. Courtesy of DuPont Permasep. In this twin design, the feedwater is fed under pressure into a central distributor tube where half the water is forced out tadiaUy through the first, ie, left-hand, fiber bundle and thus desalted. The remaining portion of the feedwater flows through the interconnector to an annular feed tube of the second, ie, right-hand, fiber bundle. As in the first bundle, the pressurized feedwater is forced out tadiaUy and desalted. The product water flows through the hoUow fibers, coUects at each end of the element, and exits there. The concentrated brine from both bundles flows through the concentric tube in the center of the second bundle and exits the element on the right.

Leading Examples Electrodialysis has its greatest use in removing salts from brackish water, where feed salinity is around 0.05-0.5 percent. For producing high-purity water, ED can economically reduce solute levels to extremely low levels as a hybrid process in combination with an ion-exchange bed. ED is not economical for the produc tion of potable water from seawater. Paradoxically, it is also used for the concentration of seawater from 3.5 to 20 percent salt. The concentration of monovalent ions and selective removal of divalent ions from seawater uses special membranes. This process is unique to Japan, where by law it is used to produce essentially all of its domestic table salt. ED is very widely used for deashing whey, where the desalted product is a useful food additive, especially for baby food. 

Equipment and Economics A veiy large electrodialysis plant would produce 500 /s of desalted water. A rather typical plant was built in 1993 to process 4700 mVday (54.4 /s). Capital costs for this plant, running on low-salinity brackish feed were 1,210,000 for all the process equipment, including pumps, membranes, instrumentation, and so on. Building and site preparation cost an additional 600,000. The building footprint is 300 itt. For plants above a threshold level of about 40 m Vday, process-equipment costs usually scale at around the 0.7 power, not too different from other process eqiiip-ment. On this basis, process equipment (excluding the ouilding) for a 2000 mVday plant would have a 1993 predicted cost of 665,000. 

The salt ions are captured by the ion exchange membranes that are present. The applications are limited to desalting amino add solutions, eg removal of HQ from L-glutamic add solution. 

Fig. 17.9. Purity comparison (SDS-PAGE) of the conventional purification process and integrated cell disrupt tion/fluidised bed adsorption.The numbers given in the flow sheet indicate the origin of samples and correspond to their respective lane numbers. Lanes M, low molecular weight markers 1, Erwinia disruptate, 15% biomass ww/v 2, eluate CM HyperD LS, fluidised bed 3, desalted eluate (after dia/ultrafiltration, 30 K MWCO membrane) 4, flow-through, DEAE fixed bed 5, elution, DEAE fixed bed 6, eluate CM HyperD LS 7, CM cellulose eluate 8, CM cellulose eluate, final 9, final commercial product.

Hyperfiltration (Reverse Osmosis) is a form of membrane distillation or desalination (desalting) operating with membrane pore sizes of perhaps 1 to 10 Angstrom units. The various individual RO component technologies have improved tremendously over the last 20 to 25 years, and resistance to fouling and permeate output rates have benefited. Nevertheless, all RO plants remain susceptible to the risk of fouling, and adequate pretreatment and operation is essential to minimize this problem. 

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

Purify the modified protein from reaction by-products by dialysis using a membrane with a low molecular weight cutoff or gel filtration using desalting resin and a buffer consisting of 50mM sodium phosphate, 0.15M NaCl, lOmM EDTA, pH 7.2. 

Belfort, G. In Synthetic Membrane Processes, Belfort, G. (ed.) (Academic Press, Orlando, 1984). Desalting experience by hyperfiltration (reverse osmosis) in the United States. 

Figure 2.13. Pore and wall structure of a modified membrane suitable as desalting membrane for RO applications (Schnabel and Vaulont 1978).

Fion, N., Gobry, V., Jensen, H., Rossier, J. S., and Girault, H. (2002). Integration of a membrane-based desalting step in a microfabricated disposable polymer injector for mass spectrometric protein... 

---