Big Chemical Encyclopedia

Chemical substances, components, reactions, process design ...

Articles Figures Tables About

Fluorogenic probes

Yatzeck MM, Lavis LD, Chao T-Y et al (2008) A highly sensitive fluorogenic probe for cytochrome P450 activity in live cells. Bioorg Med Chem Lett 18 5864—5866... [Pg.63]

Shibata A, Furukawa K, Abe H et al (2008) Rhodamine-based fluorogenic probe for imaging biological thiol. Bioorg Med Chem Lett 18 2246-2249... [Pg.63]

The PCR primers and the fluorogenic probes for the studied targets were designed using the Primer Express Software 1.7 (PE Applied Biosystem, Foster City, CA, USA). To normalize the quantitative data, specific probes for the TATA-bind-ing protein mRNA were used as an internal control. [Pg.240]

Gamer AL, St Croix CM, Pitt BR, Leikauf GD, Ando S, Koide K (2009) Specific fluorogenic probes for ozone in biological and atmospheric sample. Nat Chem 1 316—321... [Pg.197]

Song F, Watanabe S, Floreancig PE et al (2008) Oxidation-resistant fluorogenic probe for mercury based on alkyne oxymercuration. J Am Chem Soc 130 16460-16461... [Pg.103]

The intent of this chapter is not to provide an exhaustive review of chemical- and biosensors and probes, but rather to offer a brief overview of existing optical techniques and an indepth analysis of near-infrared (NIR) fluorogenic probes and sensors for the detection of metal ions, solution pH, and biomolecules and to present some of the latest results. [Pg.184]

Koo, K., and Jaykus, L.-A. (2003). Detection of Listeria monocytogenes from a model food by fluorescence resonance energy transfer-based PCR with an symmetric fluorogenic probe set. Appl. Environ. Microbiol. 69,1082-1088. [Pg.38]

Many reactions have also been carried out in water. The mechanisms of the reactions of acetone and 1,3-dihydroxyacetone using zinc-proline and related catalysts have been probed kinetically.98 The former exhibits an enamine route, whereas the latter involves rate-limiting deprotonation of the -carbon and formation of an enolate. An umbelliferyl ether of dihydroxyacetone (37) has been used as a fluorogenic probe for enolization, which may prove useful in screening of aldolases in water. [Pg.14]

A method based on inhibition of ABAP-induced oxidation of a fluorogenic probe, 2, 7-dichlorodihydrofluorescein diacetate (H2-DCF-DA), commonly used for detection of production of reactive oxygen species, has been proposed (V2). Oxidation of the probe can be monitored either spectrophotometrically or fluori-metrically. A drawback of the method is the necessity of hydrolysis of the ester because only the deesterified from can be oxidized. The rate of hydrolysis depends on the hydrolytic activity of the samples measured. A modification consisting of chemical hydrolysis of H2-DCF-DA before measurement is impractical because 2,7 -dichlorodihydrofluorescein oxidizes rapidly. [Pg.225]

Aldini et al. proposed a method for measuring TAC fractions due to hydrophilic and hydrophobic antioxidants (A6). The hydrophilic system used a water-soluble free radical initiator (ABAP) and a hydrophilic fluorogenic probe (2, 7 -dichloro-dihydrofluorescein). The hydrophobic system was based on a hydrophobic initiator, 2,2/-azobis(4-methoxy-2,4-dimethylvaleronitrile) (MeO-AMVN), and a lipophilic fluorescence probe, 4,4-difluoro-5(4-phenyl-l,3-butadienyl)-4-bora-3a, 4a-diaza-s-indacene-3-undecanoic acid (Cl 1-BODIPY581/591). The red fluorescence of the probe decreased and green fluorescence increased upon oxidation (A6). [Pg.235]

Fluorogenic probes for in vitro studies are not recommended for regulatory... [Pg.244]

PNA can also be functionalized with fluorogenic dyes, that is, dyes that exhibit enhanced fluorescence in response to a change in the environment. Unsymmetrical cyanine dyes developed originally as DNA stains can be attached covalently to PNAs to create fluorogenic probes, and chemistries have been developed that allow attachment of the dye at internal (21) as well as at terminal positions (22). [Pg.1442]

Lee LG, Connell CR, Bloch W. Allelic discrimination by nick-translation PCR with fluorogenic probes. Nucleic Acids Res 1993 21 3761-6. [Pg.1447]

Livak, K. J., Allelic discrimination using fluorogenic probes and the 5 nuclease assay. Genet Anal, 1999. 14(5-6) p. 143-9. [Pg.503]

Figure 7.5-1. A model for dual-labeled fluorogenic probes for real-time PCR. The probe is labeled with two different dyes A reporter dye is located on the 5 end, and a quencher dye is located on the 3 end. The quencher dye inhibits the natnral flnorescence emission of the reporter dye by FRET. During the elongation step, Taq DNA polymerase 5 -3 exonuclease activity hydrolyzes the probe bound to the specific DNA template, releasing the reporter dye from the target/oligonucleotide-quencher hybrid and causing an increase of fluorescence in proportion to the amount of target DNA. Figure 7.5-1. A model for dual-labeled fluorogenic probes for real-time PCR. The probe is labeled with two different dyes A reporter dye is located on the 5 end, and a quencher dye is located on the 3 end. The quencher dye inhibits the natnral flnorescence emission of the reporter dye by FRET. During the elongation step, Taq DNA polymerase 5 -3 exonuclease activity hydrolyzes the probe bound to the specific DNA template, releasing the reporter dye from the target/oligonucleotide-quencher hybrid and causing an increase of fluorescence in proportion to the amount of target DNA.
Key Words 5 fluorogenic assay fluorogenic probes TaqMan allelic discrimination high-throughput genotyping insertion/deletion polymorphisms polymerase chain reaction. [Pg.165]

Primers HD2a (5 -tgattctcagacagaacacac-3 ), HD2b (5 -caggaggacagagttctgg-3 ), and fluorogenic probe OC-2 (5 -[TET]tgatttgtcaacaacacccca[TAMRA]-3 ) were... [Pg.167]

Fluorogenic probe OC-4 (5 [6FAM]ttctcgcacagatccgtcc[TAMRA]-3 ) was custom synthesized by Applied Biosystems (AB). Note 6-carboxy-fluorescein, 6FAM). [Pg.168]

Mercury. A short account of the discovery of metal-catalyzed hydration of alkynes by Kucherov (1881) appeared on the occasion of its 125th anniversary [116]. Mercury-catalyzed hydration of alkynes has been used as mechanistic principle for devising fluorogenic probes for mercuric ions by two research teams. In one system, a 3-butyn-l-yl group at the phenolic oxygen of a fluorescein dye was cleaved via catalytic oxymercuration and elimination to releases a fluorescent dye (Scheme 20) [117]. In another system the mercury-catalyzed hydration of an ethynyl to an acetyl group provoked the quenching of fluorescence in a coumarine-based dye [118]. [Pg.142]

Fluorogenic Probes for Studies of Alzheimer s Disease-Related Proteases... [Pg.190]


See other pages where Fluorogenic probes is mentioned: [Pg.666]    [Pg.666]    [Pg.237]    [Pg.248]    [Pg.270]    [Pg.272]    [Pg.504]    [Pg.171]    [Pg.178]    [Pg.118]    [Pg.260]    [Pg.295]    [Pg.36]    [Pg.155]    [Pg.2797]    [Pg.2797]    [Pg.89]    [Pg.474]    [Pg.194]    [Pg.208]    [Pg.100]    [Pg.169]    [Pg.176]    [Pg.65]   
See also in sourсe #XX -- [ Pg.666 ]

See also in sourсe #XX -- [ Pg.96 , Pg.97 ]




SEARCH



Fluorogenic substrate probes

© 2024 chempedia.info