SYBR Green

Real-time PCR is a quantitative method for measuring amplicons as they are produced by measuring the increase in fluorescence of a dye added to the reaction mixture.12,104,105 Methods using fluorescent reporters, such as SYBR Green,104,106 TaqMan ,107,108 or molecular beacons,9 collect quantitative data at the time when DNA is in the exponential phase of amplification. 

Fukushima, H. Tsunomori, Y. Seki, R. Duplex real-time SYBR Green PCR assays for detection of 17 species of food- or waterborne pathogens in stools. J. Clin. Microbiol. 2003,41,5134-5146. 

To quantify the amount of firefly and Renilla luciferase RNAs, total RNA is extracted from transfected neurons, reverse transcribed, and subjected to real-time PCR amplification using QuantiTech SYBR Green PCR mixture (Qiagen). 

DQAsome/DNA complexes ( DQAplexes ) can be prepared by simply mixing DNA with the appropriate amount of preformed DQAsomes in salt-free 5mM HEPES buffer at pH 7.4. To choose the correct ratio between DNA and DQAsomes, the DNA-binding capacity of each new batch of DQAsomes should be determined. The quantitative DQAsome-DNA-binding assay, which has been routinely used in our laboratory, employs SYBR Green I. The fiuorescence signal of this dye is greatly enhanced when bound to DNA. Displacement of the dye from DNA results in loss of fluorescence. 

For QM-MSP, first the promoter regions of several genes will be amplified using primes that correspond to the CG-free regions (45). Then, 1 pL of the diluted PCR product (30-50 times) is used as the template in real-time QM-MSP to quantify the methylated and unmethylated template in separate reactions using methylation- or nonmethylation-specific primers. The benefits of this method are that (1) the instability of bisulfite-modified DNA is remedied using an initial round of PCR (2) nonspecific products that compromise the accuracy of SYBR green-based real-time PCR are eliminated in the second-round PCR (3) the likelihood of the development of primer dimers is minimized as the first-round PCR product is diluted 50 times and a minimal amount of MSP primers is used in the second-round PCR (4) the amount of the precious DNA used in this approach is substantially less than in the other methods. 

Chan, M. W., Chu, E. S., To, K. F., and Leung, W. K. (2004) Quantitative detection of methylated SOCS-1, a tumor suppressor gene, by a modified protocol of quantitative real time methylation-specific PCR using SYBR green and its use in early gastric cancer detection. Biotechnol. Lett. 26, 1289-1293. 

Battaglia, C., Salani, G., Consolandi, C., Bemardi, L.R., and DeBellis, G., Analysis of DNA microarrays by non-destmctive fluorescent staining using SYBR green 11, Biotechniques, 29(1), 78-81, 2000. 

A. carbonarius see A. carbonarius otapks gene, AT domain quant, real-time PCR (SYBR green 1) 141 AC12RL-OTAF AC12RL-OTAR AATATATCGACTATCTGGACGAGCG CCCTCTAGCGTCTCCCGAAG Atoui et al., 2007... 

Schnerr, H., Niessen, L., and Vogel, R. F. (2001). Real time detection of the triS gene in Fusarium species by LigthCycler-PCR using SYBR Green 1 for continuous fluorescence monitoring. Int. J. Food Microbiol. 71, 53-61. 

Instead of EtBr use less harmfull fluorescent dyes, e.g., propidium iodide (PI) or SYBR Green (cf. Haugland RP (1996) Handbook of fluorescent probes and research chemicals, 6th ed.. Chap. 8, Molecular Prohes, Eugene, Oregon https //catalog.invitrogen.com)... 

In the work of Lind et al. [69], an iCycler iQ System (Biorad) was used in combination with the intercalation marker SYBR green (Molecular Probes) for the detection of prostate-specific antigen (PSA). Once again, a high background and a bad signal-to-noise ratio limited the sensitivity improvement to an 100-fold increase of detection limit in IPCR (2.4 x 10e6 molecules, approximately 3 amol) compared to approximately 300 amol in conventional ELISA. 

The use of an intercalating dye, SYBR Green I, for real-time PCR can only be performed in an all-glass device, rather than one of PDMS-glass, because the dye and DNA appeared to migrate into the PDMS (Sylard 184) polymer [447],... 

In another report, a PDMS rotary device (12 nL) was used for PCR both spatially (moving over three temperature zones) or temporally (at three temperatures with rotary mixing). PCR of a P-actin gene (123 bp) and X phage DNA (199 bp) were demonstrated. Real-time PCR was also performed as detected by an intercalating dye (Sybr Green I) [357]. 

More recently double stranded DNA-binding dyes, (e.g., SYBR Green), have been introduced (Giulietti et al. 2001) which removed the need for an expensive, specific probe to be designed. Other sophisticated tools have been developed to work in conjunction with the Taqman method, for example molecular beacons, scorpions and hybridisation probes. These techniques rely on the FRET (Fluorescence Resonance Energy Transfer) principle but do not require the nuclease activity of the Taq polymerase. The different real-time... 

Figure 2. Allele specific determination of single nucleotide polymorphisms (SNPs). (a) The determined SNP responsible for resistance is flanked by either allele specific primes (primer pair 1 and 3 or 1 and 4, respectively) or by species specific primers (primer pairs 1 and 2). (b) The allele specific (top) or species specific (below) amplified fiagments are examined by different methods (c) yes/no answer on an agarose gel stained with ethidiiun-bromide, or with fiagments were measured in real time PCR equipment using different chemistries imiversal dye Sybr Green, fiagment specific probes (top) or allele specific probes (below).

Figure 6. Representative real-time PCR results generated using an ABI 5700 sequence detection system and sequence-specific primers for a putative 0-methyl transferase. Upper panel SYBR Green I signals generated fiom root hair cDNA vs. non-root hair cDNA. Lower panel same cDNAs used as in upper panel showing signals generated fix>m an internal control gene (18S ribo-somal RNA).

Noble, R. T., and Fuhrman, J. A. (1998). Use of SYBR Green I rapid epifluoresence counts of marine viruses and bacteria. Aquat. Microb. Ecol. 14, 113—118. 

Matsui, K., Ishii, N., Honjo, M., and Kawabata, Z. (2004). Use of SYBR green I fluorescent dye and a centrifugal filter for rapid determination of dissolved DNA in freshwater. Aquat. Microb. Ecol. 36,... 

---