EPSP

Transgenic soybean plants expressing the CTP-CP4 EPSPS display commercial levels of Roundup tolerance. These results vaUdate the importance of substrate kinetics of EPSPS in order to maintain adequate rates of aromatic biosynthesis. Furthermore, the fact that glyphosate tolerance can be obtained by expression of a glyphosate-tolerant EPSPS illustrates that the herbicidal mode of action of glyphosate is related solely to inhibition of the EPSPS reaction. 

As described earlier, translation of the EPSPS mRNA of plants results in the formation of a protein which has an AJ-terminal extension. The AJ-terminal extension, referred to as the chloroplast transit peptide, is necessary and sufficient for the import of the preprotein by the chloroplast. Once imported by the chloroplast, the transit peptide is cleaved releasing the mature enzyme. As expected, introduction of the EPSPS transit peptide to other protein sequences results in the importation of the fusion protein by the chloroplast. 

The AMPA receptors for glutamate, the nicotinic acetylcholine receptor and the 5-HT3-receptor for serotonin are cation channels (Table 1). When they open, the major consequence is a sudden entry of Na+, depolarization and an excitatory postsynaptic potential (EPSP Fig. 1). 

An inhibitory input increases the influx of Cl to make the inside of the neuron more negative. This hyperpolarisation, the inhibitory postsynaptic potential (IPSP), takes the membrane potential further away from threshold and firing. It is the mirror-image of the EPSP and will reduce the chance of an EPSP reaching threshold voltage. 

Not all influences on, or potentials recorded from, a neuron have the same time-course as the EPSP and IPSP, which follow the rapid opening of Na+ and Cl ion charmels directly linked to NT receptors. There are also slowly developing, longer lasting and smaller non-propagated (conditioning) changes in potential most of which appear to have a biochemical intermediary in the form of G-proteins linked to the activation (Gs) or... 

Figure 1.4 Ionic basis for excitatory postsynaptic potentials (EPSPs) and inhibitory postsynaptic potentials (IPSPs). Resting membrane potential ( — 70 mV) is maintained by Na+ influx and K+ efflux. Varying degrees of depolarisation, shown by different sized EPSPs (a and b), are caused by increasing influx of Na. When the membrane potential moves towards threshold potential (60-65 mV) an action potential is initiated (c). The IPSPs (a b ) are produced by an influx of Cl. Coincidence of an EPSP (b) and IPSP (a ) reduces the size of the EPSP (d)...

The 5-HT3 receptor is found appropriately in mesocortical areas and while behavioural studies with their antagonists in rodents showed potential antipsychotic activity, they have proved ineffective in patients. 5-HTia agonists may be more useful. They have been found to increase the extracellular concentration of DA in the frontal cortex of rats but diminish apomorphine-induced stereotypy (striatal effect). So they could be of some benefit, especially against negative symptoms, without causing EPSPs (see Chapter 9). 

CrylF protein, phosphinothricin acetyltransferase (PAT) 5-Enolpymvylshildmate-3-phosphate synthase (EPSPS)... 

CrylAc protein Modified EPSPS Acetolactate synthase (csr-1) CrylllA, PVY coat protein CrylllA, PLRV repUcase Nitrilase, CrylAc protein... 

Cotton Monsanto/1995 EPSPS Agrobacterium sp. strain CP4 Tolerance to the herbicide glyphosate... 

Oilseed rape (Canola) Monsanto/1995 EPSPS, glyphosate oxidoreductase (GOX) Agrobacterium sp. strain CP4, Achromobacter sp. strain LBAA Tolerance to the herbicide glyphosate... 

EPSPS RR Soy-specific EPSPS RR Soy-specific TGGCGCCCAAAGCTTGCATGGC CCCCAAGTTCCTAAATCTTCAAGT 356... 

---