Tangential-flow membrane

Ultrafiliers-UFl (Tangential Flow Membranes) Feed and Bleed 1 day... 

Hollow fiber membrane reactors are well known to provide the highest surface-to-volume ratio (Heath and Belfort, 1990). A typical system, as shown in Figure 3.6, consists of a bundle of hollow fibers that are made of hydrophobic microporous polypropylene. A tangential flow membrane has been reported by many investigators and was found to yield good results for lipase catalyzed hydrolysis and ester synthesis (Hoqetal., 1985). 

Filtration Cross-flow filtration (microfiltration includes cross-flow filtration as one mode of operation in Membrane Separation Processes which appears earlier in this section) relies on the retention of particles by a membrane. The driving force for separation is pressure across a semipermeable membrane, while a tangential flow of the feed stream parallel to the membrane surface inhibits solids settling on and within the membrane matrix (Datar and Rosen, loc. cit.). 

Asymmetric membranes have a tight, low-permeability, retentive zone that performs the desired separation and a more open, high-permeability zone that provides mechanical strength to the overall membrane. This structure is particularly critical to the economic viability of reverse-osmosis membranes. Asymmetric membranes operated in TFF mode must have the tight side facing the feed channel so that particles are retained on its surface and can be acted upon by the tangential flow. Asymmetric membranes operated in NFF mode can... 

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

All of the membrane processes utilize an engineering design known as "cross-flow" or "tangential flow" filtration. in this mechanism, the bulk solution flows over and parallel to the membrane surface, and because the system is pressurized, water is forced through the membrane. The turbulent flow of the bulk solution across the surface minimizes the accumulati.on of particulate matter on the membrane and facilitates the continuous operation of the system. 

The membrane used was 1000-dalton, tangential-flow polysulfone. 

These samples were processed through a large tangential-flow cell (regenerated cellulose membrane, Millipore Pellicon) while on station. 

Relatively few biochemicals can be measured directly in natural waters because concentrations of individual compounds are low (nanomolar) and salts and other components often interfere with these analyses. DOM can be concentrated and isolated from natural waters for more thorough chemical characterization, and two approaches for DOM isolation, adsorption onto solid phases and ultrafiltration are now widely used. The adsorption of DOM onto XAD resins is used to isolate a fraction of DOM that is operationally defined as humic substances (Thurman, 1985). More recently, tangential-flow ultrafiltration with 1000 Da cutoff membranes has been used to isolate the high-molecular-weight or colloidal fraction of DOM (Benner et al., 1992, 1997). 

---