TAMRA

Fig. 6.3. Chemical structures of rhodamine and some derivatives. TAMRA = N,N,TV,A-tetramethylrhodamine. Lissamine rhodamine = 3,5-disulfonyl-N,N, A,A-tetramethylrhodamine.

LOD is defined as the lowest concentration of an analyte that produces a signal above the background signal. LOQ is defined as the minimum amount of analyte that can be reported through quantitation. For these evaluations, a 3 x signal-to-noise ratio (S/N) value was employed for the LOD and a 10 x S/N was used to evaluate LOQ. The %RSD for the LOD had to be less than 20% and for LOQ had to be less than 10%. Table 6.2 lists the parameters for the LOD and LOQ for methyl paraben and rhodamine 110 chloride under the conditions employed. It is important to note that the LOD and LOQ values were dependent upon the physicochemical properties of the analytes (molar absorptivity, quantum yield, etc.), methods employed (wavelengths employed for detection, mobile phases, etc.), and instrumental parameters. For example, the molar absorptivity of methyl paraben at 254 nm was determined to be approximately 9000 mol/L/cm and a similar result could be expected for analytes with similar molar absorptivity values when the exact methods and instrumental parameters were used. In the case of fluorescence detection, for most applications in which the analytes of interest have been tagged with tetramethylrhodamine (TAMRA), the LOD is usually about 1 nM. 

Aneja A, Mathur N, Bhatnagar PK, Mathur PC (2008) Triple-FRET technique for energy transfer between conjugated polymer and TAMRA dye with possible applications in medical diagnostics. J Biol Phys 34 487-93... 

Recombinant MAb samples (2.5 mg) were buffer exchanged into 800 (il of 0.1 M sodium bicarbonate, pH 8.3, using an NAP-5 column. A measure of 10 pi of 5-TAMRA.SE (1.4 mg/ml) dissolved in DMSO was then added to 190 (il of rMAb solution, and the resultant mixture was incubated at 30°C for 2 h. After incubation, 190 pi of the antibody-dye conjugate was loaded into a second NAP-5 column and collected into 700 pi of 0.1 M sodium bicarbonate, pH 8.3. 

FIGURE I CE-SDS separations of non-reduced and reduced preparations of a 5-TAMRA SE-labeled rMAb sample. Electrophoretic conditions were as follows Bio-Rad Biofocus 3000 instrument with LIF detection, effective length 19.4 cm, total length 30 cm, 50-pm ID, 375-pm OD uncoated fused-silica capillary both anode and cathode buffers were the Bio-Rad CE-SDS running buffer. The samples were injected at a constant electric field of 4l7V/cm for 20s and electrophoresed at 625 V/cm (21.2 pA) and 20 C. 

FIGURE 3 CE-SDS separations of non-reduced and reduced preparations of rMAb control samples labeled with 5-TAMRA SE, and a sample that exhibited evidence of a microbial infection during cell culture fermentation. The arrows indicate the appearance of new peaks in the infected rMAb samples. (Reprinted from reference 11, with permission.)... 

FIGURE 6 CE-SDS separations under non-reduced conditions of a 5-TAMRA SE-labeled rMAb sample showing tailing of the main peak. Electrophoretic conditions as in Figure 5. 

Next, the RBDCL was screened against the TAMRA-labeled DNA sequences. As seen in Fig. 3.11, only one pool of resin showed significant fluorescence. This pool contained the monomer Cys-Ser-Ser-Quin, and as such the homodisulfide (Cys-Ser-Ser-Quin) was selected as the best binder. Equilibrium dialysis experiments confirmed that (Cys-Ser-Ser-Quin) bound the target DNA Sequence 2 with a dissociation constant of 2.8 tM. While it is certainly true that identification of amplified compounds from large solution-phase DCLs is possible, given sufficiently... 

AversRl probe AversPl CCATTGTTGAAAGTTTTGACTGATTTTA FAM-AGACTGCATCACTCT CAGGCATGAAGTTCAG-TAMRA Vesper, 2000... 

AGE — agarose gel electrophoresis, BAL = bronchoalveolar fluid, FAM = 6-carboxyfluorescein label, MGB = minor groove binder, n.s. - not specified, RAPD = randomly amplified polymorphic DNA, RT-PCR = reverse transcription PCR, TAMRA = 6-carboxytetramethylrhodamine label. 

This approach has been shown to work with a number of different fluorescent probes such as the short-wavelength fluorophores dansyl sul-fonyl chloride and coumarin chloride and the long-wavelength fluorophores tetramethylrhodamine-5-(and-6)-isothiocyanate [5(6)-TRITC], 5-(and-6)-carboxytetramethylrhodamine, succinimidyl ester [5(6)-TAMRA, succin-imidyl ester] and lissamine rhodamine B sulfonyl chloride (each in conjunction with different binding functionalities on the SAM surface. 

---