Plasmids, purification

A significant feature of plasmid purification employing capture chromatography (i.e. involves plasmids binding to the chromatographic beads) is the low plasmid-binding capacities observed. 

It is beneficial to identify clones that contain the correct insert prior to plasmid purification and sequencing. The following protocol for colony PCR utilizes primers that anneal to the vector sequence, which is advantageous because one optimized set of PCR conditions is used. This allows for easy preparation, and avoids problems related to different primer conditions. In addition, a negative control of vector DNA can serve as a built-in control for the reaction. Primers should be chosen that produce a product of approx 100 bp when vector DNA without insert is amplified. To amplify the pNHis vector, the T7 promoter (5 TAATACGACTCACTATAGGG 3 ) and T7 terminator (5 GCTAGTTATT GCTCAGCGG 3 ) primers were used. 

PCR Prepare PCR DNA template using standard plasmid purification techniques. In a total reaction volume of 500 p prepare the following reaction mix 50 ng template DNA, 1 pM forward PCR primer, 1 pM reverse PCR primer, 0.2 pM dNTP mix, 5 pi Taq Phusion enzyme in 1 X Phusion HF buffer, adding the enzyme last. Aliquot into five PCR reaction tubes (100 /il/tubc) and perform the PCR reaction in a thermocycler. 

Plasmid purification by anion exchange chromatography may be performed using the Qiagen (Chatsworth, CA) kit. 

An alternative plasmid purification kit is available from Machery-Nagel (Nucleobond, Duren, Germany). 

Plasmid purification methods vary in the time, expense, and equipment required and in the purity of the plasmid produced. Purity is important to generate high levels of transfection in a reproducible manner. Potential contaminants include bacterial genomic DNA, RNA, protein, endotoxin, chemical residues, trace metals, and undesirable counterions (159). Depending on the user s endpoint, concern regarding any of these contaminants will vary. For example, if the plasmid product is intended for human clinical trials, strict quality control over of all these factors, among others, must be addressed. Lesser concern is warranted for... 

DNA template preparations are a major source of contamination in cell-free synthesis. In vitro translation reactions are sensitive to contamination by salts, RNases, detergents, and alcohol, all of which are typically used in commercial plasmid purification kits. As such, plasmids prepared by resin-based purification protocols must be further purified by phe-nol/chloroform and chloroform extraction. DNA should be precipitated with isopropanol, washed in ethanol, dried, and taken up in RNase-free water to a concentration of about 1 mg mL . The DNA should be stored frozen, in small aliquots. 

Plasmid purification Ultra centrifugation (mutagenic reagents and ethidium bromide) lEC (gravity flow columns provided in commercial kits) RPC (organic, toxic solvents) tEC and/or SEC (use only GRAS reagents)... 

Prepare transfection-grade pMSHlTH and/or pMSH2TH DNA using a plasmid purification kit according to the manufacturer s protocol. 

The BIG2 plasmid is purified using a QIAGEN plasmid purification kit. Note from colonies of five plates, the plasmid yield is usually... 

Extract the mini-X, DNA from the cells using a plasmid purification kit. 

Recent Advances in DNA Separations Plasmid Purification, Rapid Electrophoresis, and Affinity-Based Recovery James W. Schneider and... 

---