Plasmid insert purification

Three to several colonies for each sample are inoculated into the same 600 pL of LB medium containing 50 pg/mL of kanamycin and cultured at 37°C overnight. For glycerol stock, 50 pL of the culture is added to 25 pL of Cell Stock Buffer in a 96-well plate. The remaining suspensions are applied to the plasmid preparation with the Wizard SV 96 Plasmid DNA Purification System see Note 6). One microliter of the resultant plasmid solution is directly applied to agarose gel electrophoresis for estimation of the size of plasmid in a form of covalently closed circular. Similarly, another 1 pL of the plasmid solution is treated with S fi/Pmel and analyzed by agarose gel electrophoresis for an insert size check. This plasmid solution set is the final product and is reserved in a freezer. 

It is beneficial to identify clones that contain the correct insert prior to plasmid purification and sequencing. The following protocol for colony PCR utilizes primers that anneal to the vector sequence, which is advantageous because one optimized set of PCR conditions is used. This allows for easy preparation, and avoids problems related to different primer conditions. In addition, a negative control of vector DNA can serve as a built-in control for the reaction. Primers should be chosen that produce a product of approx 100 bp when vector DNA without insert is amplified. To amplify the pNHis vector, the T7 promoter (5 TAATACGACTCACTATAGGG 3 ) and T7 terminator (5 GCTAGTTATT GCTCAGCGG 3 ) primers were used. 

The procedure for insulin is more complex because insulin is synthesized as preproinsulin and must be processed to yield the A and B chains of insulin (page 415). Bacteria do not have the processing system for converting the precursor to insulin. The appropriate cDNAs for the A and B chains were coupled into individual plasmids and each inserted into separate bacteria for production of the A and B chains. Following purification of the individual chains/ the proper disulfide bonds were chemically formed to yield the mature insulin. 

Figure 10-2 The pGEX-2T plasmid. Multiple-cloning site allows genes of interest to be inserted in frame with the GST coding sequence to express the gene as a GST fusion protein that is easily purified with affinity chromatography. The GST tag can be removed after purification by treatment with thrombin.

Screening by antibody is an option if the bacteria and plasmid are designed to express proteins from the cDNA inserts (see Expression clones ). The principle is similar to hybridization, in that you lift replica filters from bacterial plates, but then you use the antibody (perhaps generated after olde tyme protein purification rituals) to show which colony expresses the desired protein. 

An interesting approach to selectively label regions outside the probe is to tall ds molecules (e.g., inserts from plasmids or PCR-pro-duced duplices) with C-homopolymers and to transaminate these tails without heat-denaturation of the duplex. Subsequent restriction of the duplex and purification of the fragments yields strand-specific probes. 

The wild-type (25)s insert is purified from the plasmid and end-labeled with Klenow fragment exactly as described for the Southwestern experiment, except that we start out with 50 /xg plasmid to get a final yield of approximately 2 /xg of insert. The 2 jxg of insert is labeled separately in two reactions, as described for Southwestern probe labeling. It is important that the probe has a high specific activity. After purification through Sephadex G50, radioactivity of the probe is measured by scintillation counting. Expect to get at least 2x10 cpm//xl, or 2 x 10 cpm in 100 /xl. Total counts are 4 x 10 in 200 /xl. Add directly to 100 ml hybridization buffer. 

If the plasmid is to be labeled directly, without either PCR amplification of the insert or gel purification of the insert see Chapter 11), then the plasmid will require purification on cesium chloride (CsCl). If this is the case the procedure described in Section 3.2. should be followed, after obtaining an initial purification of the plasmid as described in Section 3.1. If CsCl purification is to be used then it is advisable to extract DNA from larger volumes of culture (10 mL is... 

---