Colony PCR

Fig. 2. Structures of expression vectors for N-terminal GST-fused (a) and MBP-fused (b) proteins. Km is an abbreviation for kanamicin resistance. The figure also indicates the location of fhe primer pair used for DNA sequencing and colony PCR.

To identify colonies with inserts in the correct orientation, either perform colony PCR (see Note 4) or prepare plasmid DNA, and perform analytical restriction mapping to determine the orientation of the inserts (see ref. 10). 

After transformation, analyze the transformant with colony PCR or plasmid mini-prep procedures and check the restriction enzyme sites by digestion. 

It is beneficial to identify clones that contain the correct insert prior to plasmid purification and sequencing. The following protocol for colony PCR utilizes primers that anneal to the vector sequence, which is advantageous because one optimized set of PCR conditions is used. This allows for easy preparation, and avoids problems related to different primer conditions. In addition, a negative control of vector DNA can serve as a built-in control for the reaction. Primers should be chosen that produce a product of approx 100 bp when vector DNA without insert is amplified. To amplify the pNHis vector, the T7 promoter (5 TAATACGACTCACTATAGGG 3 ) and T7 terminator (5 GCTAGTTATT GCTCAGCGG 3 ) primers were used. 

Identification of recombinant vectors Each eight clones were selected for colony PCR from plates containing pT-uvrA and pT-alkA vectors, all the clones were positive except clone 3 of the pT -uvrA vector (Fig. 2.). 

Verify the successful fusions by using colony PCRs and extract plasmids from verified colonies for DNA sequencing. 

On the following day, select 6-8 single colonies from the transformation plate, and perform colony PCR (see step 11, below) to verify that the PCR fragment was cloned (see Note 6). 

Colony PCR is an optional step, although highly recommended. Before selecting clones for DNA sequencing it is advisable to perform colony PCR to ensure that the selected clones harbor the target gene. 

Colonies that develop pale blue color or do not develop blue color by 18-h incubation with 5-bromo-4-chloro-3-indolyl-y8-D-galactopyrano-side, are picked up and subjected to colony PCR and sequence analysis. 

Figure 4.6 Template plate label for tracking colony PCR.

Fig. 3. After 20 cycles of amplification, colony PCR products for each colony were run on a 0.9% agarose gel. Selected colonies were numbered, and the negative colony labeled N. Colonies 5 and 10 have an insert size bigger than the negative control and roughly the expected insert size for the DNA part (1,100 bp).

After overnight incubation of the transformed cells, pick colonies from the ligation and the control plates for colony PCR to quickly test if the ligation was successful in any of the colonies (see Subheading 3.8). 

Grow clones with positive results from the colony PCR overnight in tubes of 2 mL LB media containing the appropriate antibiotic. 

Colony PCR 24 white colonies are grown overnight and used as template in a PCR reaction with T7 and SP6 primers to check for full-length inserts. 

---