CD spectra of DNA

Fig. 2. (A) CD spectra of free DNA and DNA with rHMfB at mass ratios of 0.1, 0.2, and 1.3. The peak at 275 nm is depressed on histone binding. (B) CD spectra of rHMfB and BSA, showing no peaks at 275 nm. (C) CD spectra of DNA alone and mixed with BSA, showing no change in the 275 nm DNA peak.

There have been a number of studies (Ivanov et al., 1973 Zimmer and Luck, 1974) that attribute the linear changes in CD spectra of DNA on increasing liQ and NaQ concentrations to a continuous change of the DNA structure toward a C form, although this interpretation has been disputed by Zimmerman and Pheiffer (1980). Other studies have shown that the CD spectral changes can be relateid to a change in the number of base pairs per turn of the double helix (Basse and Johnson, 1979) or a change in... 

Fig. 5.5 CD spectra of (a) DNA d(A3GGAGGA3) alone, (b) aPNA CCTCC(b2) alone, and (c) a 1 1 mixture of d(A3GGAGGA3)-rCCTCC(b2) (6 pM each) in HjO. (See [51] for experimental details. Reprinted with permission from Garner P, Dey S, Huang Y. /. Am. Chem. Soc. 2000, 122, 2405)...

These CD studies confirmed the binding stoichiometries of our aPNA-DNA complexes and provided further support for our binding model. Comparisons between the CD spectra of the individual components and the aPNA DNA complex suggest a template effect (not unhke that observed with certain DNA-binding proteins) where the components induce mutual conformational changes upon their interaction with each other. 

Figure 4 shows CD spectra of (a) the DNA-lipid complex in organic solution containing a small amount of water (CHCl3/Et0H/Fl20 =4 1 0.07, 790 mM of H2O), and (b) native DNA in an aqueous buffer solution (20 mM NaCl, 10 mM Tris, pH 7.8). The DNA-lipid complex shows a positive Cotton effect at 270 nm and a negative Cotton effect at 245 nm similar to native DNA in aqueous solution, which indicates the B-form structure for the DNA strands [11]. Thus, the DNA-lipid complex forms a double helical B-form... 

Fig. 4 CD spectra of a DNA-lipid complex in CHCl3/Et0H/H20 = 4 1 0.07, and b native DNA in aqueous buffer solution (20 mM NaCl, pH 7.8, 10 mM Tris, [DNA] = 50 riMbp 23 °C)...

Fig. 5 Effect of water contents on CD spectra of the DNA-lipid complex in CHCI3 /EtOH (4 1) solution ([DNA] = 50 p.Mbp , 23 °C)...

When the stretched film was dried in air (simply applying a hair-dryer for 2 min), only diffraction on the equator as two spots of 41 A was observed but not diffraction on the meridian for base-pairs (Fig. 7c). This suggests that the orientation of the base pairs is not perpendicular to the stretched direction, although the DNA strands are aligned parallel to the stretched direction. Figure 8 shows CD spectra of the cast film of the DNA-lipid complex in wet (a) and dry states (b). The CD spectrum of the wet film was consistent with a B-form structure of native DNA in fibers obtained from aqueous solution [1-3]. On the contrary, the CD spectrum in the dry state resembles the A-form of DNA in which the base pairs slant to the axis of the strands [2,3]. These results are consistent with CD spectra of the DNA-lipid complex in an organic solution DNA exists in the B-form in the presence of water and the C-form in the ab-... 

Fig. 8 CD spectra of the cast film of the DNA-lipid complex a in water and b in the dry state (23 °C, film thickness 3 jlM)...

Figure 13. CD spectra of various substituted acridines upon binding to calf thymus DNA. Data are shown for (a) 1-aminoacridine, (b) 2-aminoacridine,...

The CD induced in the visible absorption bands of proflavine cation intercalated to DMA was characterized in terms of the dye-DNA base pair exciton interactions [84]. In this work, the data were obtained at very low amounts of intercalated solute relative to the amount of oligonucleotide, with the goal of observing the CD spectra of isolated and monomeric dye systems. Substantial ionic strength effects were noted, indicating the electrostatic nature of the interaction. Comparison of the data with the results obtained after theoretical modeling indicated that the proflavine molecules insert in the DNA helix with the molecular plane parallel to the stacking plane of the DNA base pairs. 

Figure 4.9 CD spectra of fixed concentration of plasmid DNA titrated with an increasing concentration of an adenoviral peptide, /x, known to template with DNA and induce condensation. Data illustrates that the peptide binding induces base-pair tilting and subsequent supercoiling (Chapters 1 and 7). Arrow shows direction of spectral increase with increasing /x peptide (Reproduced from Preuss et al., 2003, Fig. 4A).

Fig. 2. Difference CD spectra of four oligomer duplexes, a DNA-DNA duplex (—), an...

The CD spectra of three triplexes are given in Fig. 7A. Two interesting conclusions were drawn from the spectra. First, the CD spectrum of the DNA triplex was much different from those of the RNA triplex and the one hybrid triplex that could be formed under the conditions (see legend to Fig. 4). This was consistent with molecular mechanics calculations that showed that DNA helices with alternating C" - G-C and T-A-T base triples can have predominately C2 -endo sugars, except for cytidines in the third strand. Second, the CD spectra of the other two triplexes were similar and A-like, indicating that the conformation of the hybrid triplex was close to that of the RNA triplex. The hybrid triplex had a d(AG),2... 

The CD spectra of proteins and nucleic acids overlap extensively, but the spectra are complementary in a sense. In the region above 240 nm DNA and RNA have strong CD bands, whereas those of the aromatic side chains of the protein are relatively weak. Conversely, in the 210-230 nm region, protein CD is strong and nucleic acid CD, especially for B-DNA, is weak. These two windows therefore permit one to obtain information on the conformation of each of the two partners in nucleopro-tein complexes. 

Figure 1 CD spectra of (left) B-DNA and A-DNA of d(GCGGCGACTGGTGAGTACGC) duplexed with Its complementary sequence, and (right) A-RNA of the duplex with the same nucleotide sequence (with U instead of T). The NA samples were dissolved in 1 mmol I" Na phosphate -i- 0.3 mmol I" EDTA, pH 7. Trifluorethanol was added to DNA up to 80% to induce the A-form. Spectra were taken at 0°C.

Rgure 19 CD spectra of duplex DNAs (pH = 6.8, 5 mw NaCI, 1 mw cacodylate) of varying G-C base pair content Clostridium perfringens (26% GC), calf thymus (42% GC), Micrococcus lysodeikticus (72% GC), poly[d(G-C)]2 (100% GC). Also shown is Z-form poly[d(G-C)]2 (100% G-C, pH = 6.8, 5 mw NaCI, 1 mM cacodylate, 50 jjim [Co(NH3)e] ). The 195 nm negative signal of Z-DNA Is obscured by the CD induced into the transitions of [Co(NH3)f when this molecule Is used to induce Z-form DNA. (Source Circular dichroism and linear dichroism, A. Rodger and B. Nord6n, 1997, by permission of Oxford University Press.)... 

Study of the CD spectrum of DNA in the presence of Mn(II), Zn(II), and Co(II) indicated that the metal ions induced a B C conformational change. The CD spectra are altered at very low concentrations, and the transformation is considered to occur via reduction of electrostatic repulsive interactions as the cations bind along the phosphate backbone and in the helical grooves [86]. 

Circular dichroism spectra of DNA and RNA also depend strongly on the molecular structure. As shown in Fig. 9.11, B-form DNA typically has a CD band with positive rotational strength near 185 nm and negative bands in the regions of 200 and 250 nm, while Z-form DNA has positive bands at 180 and 260 nm and negative bands at 195 and 290 nm. 

Fig. 12.39 Representative CD spectra of polypeptides and polynucleotides (a) random coils, a helices, andp sheets have different CD features in the spectral region where the peptide link absorbs (b) B- and A-DNA can be distinguished on the basis of CD spectroscopy in the spectral region where the bases absorb.

---