AFLP markers

A. carbonarius see A. carbonarius AFLP marker PCR 189 AlB fw AlB rv GAATTCACCACACATCATAGC TTAACTAGGATTTGGCATTGAAC Schmidt et al., 2004a... 

G. AFLP marker-based primers for A. ochraceus and A. carbonarius... 

Schmidt, H., Taniwaki, M. H., Vogel, R. F., and Niessen, L. (2004a). Utilization of AFLP markers for PCR-based identification of Aspergillus carbonarius and indication for its presence in green coffee samples. J. Appl. Microbiol. 97, 899-909. 

Langer, K., Lorieux, M., Desmarais, E., Griveau, Y., Gentzbittel, L., and Berville, A., Combined mapping of DALP and AFLP markers in cultivated sunflower using F9 recombinant inbred lines, Theor. Appl. Genet., 106, 1068-1074, 2003. 

Quagliaro, G., Vischi, M., Tyrka, M., and Oliviera, A.M., Identification of wild and cultivated sunflower for breeding purposes by AFLP markers, J. Heredity, 92, 38 -2, 2001. 

Blaich, R., Konradi, J., Ruhl, E., Forneck, A., 2007. Assessing genetic variation among pinot noir (Vitis vinifera L.) clones with AFLP markers. Am. J. Enol. Vitic. 58 (4), 526-529. Online verfugbar unter. http //www.ajevonline.Org/cgi/content/abstract/58/4/526. 

S. Rosendhal and J. W. Taylor, Development of multiple genetic markers for studies of genetic variation in arbuscular mycorrhizal fungi using AFLP. Mol. Ecol. 6 821 (1997). 

Peleman, J., Application of the AFLP technique in marker assisted breeding, in Which DNA for Which Purpose Gillet, E.M., Ed., 1999, http //webdoc.gwdg.de/ebook/y/1999/whichmarker/ml4/Chapl4. htm. 

Keywords AFLP Microsatellite marker Phaeocystis P. antarctica P. globosa ... 

Fig. 12. Digital electrophoresis image of AFLP fragments of Candida strains run on an automatic DNA sequencer. Markers lanes 1,16, 25, 34 Candida guilliermondii clinical isolates, lanes 2-6 Candida glahrata type strain CBS 138 lane 7, clinical isolates others.

Figure 3 Population genetic methods used in genetic ecotoxicology to examine toxicant effects in populations of aquatic and terrestrial organisms. Methods are categorized as either co-dominant (allozymes, minisatellites, RFLP, microsatellites) or dominant (AFLP, FiAPD) markers. As shown here, techniques used to generate these markers are based on similar procedures such as PCR and electrophoresis, and similar methods of analysis, bp, base pairs.

Structure was determined by means of AFLP analysis (Jarraud et al. 2002 Boerema et al. 2006 Melles et al. 2008). High-throughput AFLP (htAFLP) to characterize molecular markers associated with bacterial phenotypes was described recently (Savelkoul et al. 2007 Melles et al. 2009). Results of AFLP seem to be highly concordant with those of MLST in the delineation of genotypic clusters of closely related isolates (Sakwinska et al. 2009). 

Gallego, F. J., Perez, M. A., Nunez, Y., Hildago, P. (2005). Comparison of RAPDs, AFLPs and SSR marker for genetic analysis of yeast strains of Saccharomyces cerevisiae. Food... 

SOKOLOVA I M, OLIVER j D, LEAMY L j (2006), An AFLP approach to identify genetic markers associated with resistance to Vibrio vulnificus and Perkinsus marinus in eastern oysters. / Shellfish Res, 25, 95-100. 

---