Xylene-cyanol

Xylene cyanole FF 1.00 trans) Yellow-green to pink... 

Xylene cyanole-methyl orange indicator, Schoepfie modification (for partially color blind operators) dissolve 0.75 g xylene cyanole FT (Eastman No. T 1579) and 1.50 g methyl orange in 1 liter of water. 

Chloride is determined by titrating with Hg(N03)2, forming soluble HgCb-The sample is acidified to within the pH range of 2.3-3.8 where diphenylcarbazone, which forms a colored complex with excess Hg +, serves as the visual indicator. Xylene cyanol FF is added as a pH indicator to ensure that the pH is within the desired range. The initial solution is a greenish blue, and the titration is carried out to a purple end point. 

X-ray methods 9 X-rays 9, 647 Xylene cyanol FF 268 Xylenol orange 319 Xylidine ponceau 405... 

After cooling and dilution with methyl-Cellosolve (2-methoxyethanol), acetic anhydride is slowly added (in order to convert the secondary amine to amide) and the solution is cooled to room temperature. Finally, the resulting tertiary amine, representing the original unsaturate, is titrated with 0.5 N perchloric acid in methyl-Cellosolve, either visually (with thymol blue + xylene cyanol... 

Immediately after irradiation, stop the reaction by the addition of 7 pi of 4 X SDS electrophoresis loading buffer or the equivalent (with a high concentration of reducing agent present) 0.2M Tris, 8 percent SDS, 2.88M P-mercaptoethanol, 40 percent glycerol, 0.4 percent xylene cyanol, 0.4 percent bromophenol blue. Heat the sample at 95°C for 5 minutes and analyze the complexes formed by electrophoresis. 

Figure 10.7 Electrophoretogram of dendritic nucleic acid 4 (lane 2) and a linear analog of identical base composition (lane 3). Lanes 1 and 4 marker dyes xylene cyanol (XC) and bromophenol blue (BPB). (Reprinted with permission from reference 23, copyright (1993) American Chemical Society.)...

Prepare a small well containing a mix of bromophenol blue and xylene cyanol in order to follow the migration. 

EXAMPLE 12.5 Estimation of Number of Nucleotides in Glycine tRNA Using Electrophoresis. Synthetic DNA standards and RNA molecules were electrophoresed in 7 M urea solution on cross-linked polyacrylamide gels (Maniatis et al. 1975). A semilog plot of the number of nucleotides versus the mobility relative to xylene cyanol FF dye is linear and includes the points (N = 100, u i = 0.33) and (N = 50, urei = 0.55). Estimate the number of nucleotides in the glycine tRNA molecule of Staphylococcus epidermidis if it shows a relative mobility of 0.16. 

The analysis may be performed by titrimetiy using a suitable indicator. Diphenyl carbazone is a choice indicator that forms a purple complex with excess mercuric ions in the pH range of 2.3 to 2.8. Therefore, the pH control is essential in this analysis. Xylene cyanol FF is added to diphenyl carbazone to enhance the sharpness of the end point in the titration. Nitric acid is used to acidify the indicator to the required low pH range. 

Indicator solution. To 100 mL 95% ethanol or isopropyl alcohol, add 250 mg 5-diphenyl carbazone, 4 mL cone. HN03, and 30 mg xylene cyanol FF. Store in a refrigerator in an amber bottle. 

Loading solution (90% formamide, trace amounts of bromphenol blue and xylene cyanol)... 

For the folding reactions (5-10 iL), labeled ribozyme (1000-2000 cpm/ fiV) is added to HE buffer (50 mM Hepes adjusted to pH 7.5 with sodium hydroxide, 1 mMEDTA, pH 8), 10% (v/v) glycerol, 0.01% (w/v) xylene cyanol, plus the desired concentration of MgCl2 or other salt (Heilman-Miller et al, 2001 Koculi et ah, 2004). At least one sample should contain no MgCl2, representing the unfolded RNA, and one sample should contain enough MgCl2 to fold the RNA completely. The reactions are incubated at the desired temperature for sufficient time for the reaction to reach equilibrium. We incubate the Tetrahymena ribozyme 2-4 h in a water... 

Marker dye mixture Mix equal volumes of 1% Xylene Cyanol F.F. (blue), 2% Orange G (yellow) and 1% Acid Fuchsin (pink) (all from George T. Gurr, Ltd., London.)... 

Load 3-5 /xl onto thin 8% sequencing gel (below). Electro-phorese at constant 30 mA ( 1200 V) until the slow blue marker dye (xylene cyanol FF) reaches the bottom of the gel. 

Gently stir 100 ml formamide with 5 g Amberlite MB1 (mixed bed resin) for 30 min. Remove resin by filtration. Add 0.3 g xylene cyanol FF, 0.3 g bromo-phenol blue and Na2EDTA to 10 mM. Store at 4°C. 

Fig. 3.8. Line diagram of a sequencing gel (Baines, 1978) showing application of the partial ribosubstitution method to the analysis of a cloned DNA sequence. Sequence deduced AAAAGTGGTTTAGGTTAAAAGGTATC AAATG AAT AAGC ATTCGATCGG AA r till. .. xc, position of the xylene-cyanol FF dye...

To terminate the reaction the capillary contents are ejected into 5yu.l formamide dye mix (99% deionized formamide containing 10 mM EDTA, 0.2 mM NaOH, 0.1% xylene cyanol FF dye). After denaturation at 100°C for 30 s the samples are applied directly into gel wells and electrophoresis carried out by the usual method (Section 3.1.2.). Seif et al. (1980) give a recommended order of loading ... 

A second loading is usually made after 90-100 min. by which time the slower moving dye band (xylene cyanol) should have migrated half way down the gel. Before the second loading the samples should again be briefly boiled and the wells rinsed out with buffer to remove urea that has leached out of the gel. Electrophoresis is terminated when the xylene-cyanol band from the second loading reaches the bottom of the gel. 

If less than about 100 nucleotides are to be sequenced the whole of each sample can be loaded onto the gel and electrophoresed until the xylene-cyanol dye marker (turquoise) has moved about a third of the way down the gel, (xylene-cyanol runs with fragments about 70 nucleotides long on an 8% gel). If sequences of 200 or more nucleotides are to be determined multiple loadings of the... 

---