Sinefungin

As shovm in Eq 6 59, Rapoport has prepared sinefungin, nucleoside andbiodcs, via nitro-aldol reaction, dehydradon, and reducdon v/iihZn in acetic acid fi-Niiro styrenes are selecdvity reduced to the corresponding oximes by indium metal in aqueous methanol under neutral conthdons ... 

Chrebet, G. L., Wisniewski, D., Perkins, A. L., Deng, Q., Kurtz, M. B., Marcy, A., and Parent, S. A. (2005). Cell-based assays to detect inhibitors of fungal mRNA capping enzymes and characterization of Sinefungin as a cap methyltransferase inhibitor.J. Biomol. Screen. 10, 355-364. 

Amur SG, Shanker G, Cochran JM, Ved HS, Pieringer RA (1986) Correlation between inhibition of myelin basic protein (arginine) methyltransferase by sinefungin and lack of compact myelin formation in cultures of cerebral cells from embryonic mice. J Neurosci Res 16 367-376 An W, Kim J, Roeder RG (2004) Ordered cooperative functions of PRMTl, p300, and CARMl in transcriptional activation by p53. Celll 17 735-748... 

Scheme 4 inactivation of ACS through reaction of its cofactor PLP with the inhibitors (a) PLP forms a ketimine with aminoethoxyvinyigiycine (AVG) (b) PLP forms oxime with AMA, the aminooxy anaiogue of SAM (c) ACS inactivated by antifungai antibiotic sinefungin, the anaiogue of SAM. in this case, the structure of inhibitory adduct is stiii unknown ( ). PLP is marked in biue. Notations are as in Schemes 2 and 3. 

ACS isozymes differ from each other in their sensitivity to inhibitors. For example, the eight catalytically active ACS isozymes from Arabidopsis have Ki values for AVG and sinefungin ranging from 0.019 to 0.8 and 0.15 to 12pmol, whereas those from the crude extract preparation of tomato fruit have 1) values for the same inhibitors ranging from 0.2 to 10 and 1.0 to 25 pmol, respectively. ... 

Vedel, M., Lawrence, F., Robert-Gero, M. and Lederer, E. (1978) The antifungal antibiotic sinefungin as a very active inhibitor of mefhyltransferases and of the transformation of chick embryo fibroblasts by Rous sarcoma virus. Biochemical and Biophysical Research Communications, 85, 371-376. 

Eco57l- sinefungin TTCGATGTGCTGAAGTTTAGACCTG GCTACACGACTTCAAATCTGGACTT 4.2 Tamulaitiene etal, 2004... 

G Schluckebier, M Kozak, N Bleimling, E Weinhold, W Saenger. Differential binding of S-adenosylmethionine, S-adenosylhomocysteine and sinefungin to the adenine-specific DNA methyltransferase M.Taql. J Mol Biol 265 56-67, 1997. 

This alkylation strategy has been successfully implemented to the diastereoselective synthesis of a number of biologically active compounds,17 19 32 72 73 including the orally active HIV protease inhibitor Crixivan (>95% de)17-19 and nucleoside antibiotic (+)-sinefungin (51) (>99% de).72 The C-6 amine stereochemistry of (+)-sinefungin was set by a highly diastereoselective allylation of (lS,2/ )-l-amino-2-indanol-derived oxazolidinone 52 (Scheme 24.10). 

Sinefungin 109 is an important antibiotic78 with anti-fungal, anti-parasite and strong anti-AIDS activity. It also shows... 

The aldol reaction illustrated in eq 2 has been applied to the targeted synthesis of a number of complex molecules including Tylosin, Hapalosin, the antibiotic Sinefungin, and the HIV protease Saquinavir inhibitor. Oxazolidinone-type chiral auxiliaries derived from 1 have also been employed for the control of Diels-Alder reactions of attached acryloyl or crotonyl groups. ... 

A swap of the methyl carbon with nitrogen in aza-AdoMet leads to sinefungin (see Fig. 2g)—a natural nucleoside antibiotic found in Streptomyces griseolus. Such reverse chemistry additionally enhances the chemical stability of cofactor. Because of the positive charge of the protonated amine and correct chirahty at the carbon center, sinefungin has an extremely high inhibitory potential for AdoMet-dependent methyltransferases. 

Sinefungin [inn. usan) is a nucleoside ANTIBIOTIC with ANTIPROTOZOAL properties. 

Starting from the phosphonate (99), Geze et al. [75] have synthesized sinefungin as described in scheme 4. 

---