Phosphorothioate anion

The ambident phosphorothioate anion (122) yields O-metalloidal derivatives when treated with chlorides of Group IV elements.92... 

C, Liang and L. C. Allen, / Am. Chem. Soc., 109, 6449 (1987). Sulfur Does Not Form Double Bonds in Phosphorothioate Anions. 

A theoretical analysis has been made of che dual reactivity of salts of phosphorus(V) thio acids. In alkylation reactions, the variation in products brought about by changes in alkylating agent can be illustrated by reference to the diethyl phosphorothioate anion for this, triethoxonium fluoroborate yields almost exclusively the S-ethyl derivative, alkyl tosylates in HMPT react to yield both S and 0-alkyl derivatives, and chlorotrimethylsilane reacts only at oxygen. S-alkylation occurs almost exclusively in non-polar or weakly polar solvents, but also in ethanol. In HMPT the S 0 ratio was shown to depend on the substituents attached to phosphorus. It was suggested that 0-alkylation occurs when the free ion is available, whereas reaction at sulphur occurs when the oxygen end of the 0-P-S triad is preferentially solvated and so shielded. 

Liang, C. and Allen, L C. (1987) Sulfur does not form double bonds in phosphorothioate anions. J Am, Chem, Soc, 109, 6449-6543... 

For the studies discussed below, a 25-mer phosphorothioate with the sequence ctctcgcacccatctctctccttct was used. The HIC packing material used was Phenyl Sepharose fast flow, high substitution (Pharmacia). The anion IEC packing material was DEAE 5PW (TosoHaas Philadelphia, PA). The DEAE elution pool was desalted using ultrafiltration on tangential flow filtration membrane cassettes (Pall Filtron Northborough, MA). The entire process took 2 days, as opposed to 4 days for a previously used RPLC procedure. 

Puma, P., Duffey, D., and Dawidczyk, P., U.S. Patent appl. 94,944, Purification of oligodeoxyribonucleotide phosphorothioates using DEAE-5PW anion ion-exchange chromatography and hydrophobic interaction chromatography, 1994. 

Bourque, A. J. and Cohen, A. S., Quantitative analysis of phosphorothioate oligonucleotides in biological fluids using fast anion-exchange chromatography, J. Chromatogr., 617, 43, 1993. 

The authors have also studied the deprotection by less basic nucleophiles such as thiophenolate and iodide. Deprotection by the latter anion may lead to a side-reaction when condensation of the allyl iodide formed with the de-protected phosphorothioate leads to the corresponding S-allyl phosphoroth-ioate. To suppress this side reaction thiourea was used to trap the allyl iodide. 

In a recent series of studies focused on the synthetic utility of alkenyliodo-nium salts, ( )-/J-phenylethenyl(phenyl)- and ( )-l-hexenyl(phenyl)iodonium tetrafluoroborates, 22 and 23, were utilized for alkenylations of a range of soft, anionic nucleophiles (Scheme 45) [128-135]. In all cases but one, alkenylations with 22 occurred with retention of configuration, while alkenylations with 23 occurred with inversion of configuration. Only the dialkyl phosphoroselenolate salts gave mixtures of (Z)- and (fj)-products with 22 [132]. Furthermore, although cuprous iodide was used to catalyze the reactions of 22 and 23 with the phosphorothioate and -dithioate salts, the stereochemical results were the same [131,133]. It was generally assumed that retention was an outcome of the ligandcoupling or addition-elimination pathways, while stereochemical inversion was attributed to the vinylic... 

FIGURE 3 (A) Representative analytical anion exchange (AX) trace for crude 20 mer phosphor-othioate and (B) representative QCGE trace for the same oligonucleotide. Conditions for the analytical AX Column, resource Q I mL column (6.4 X 30 mm) buffer A, 20 mM NaOH buffer B, A + 2.5 M NaCI gradient, 0- 100% B in 50 min, temperature 70°C sample, ISIS 2302 crude, a 20 mer phosphorothioate. Conditions for analytical QCGE column eCap gel-filled capillary (Beckman-Coulter, Fullerton, CA), 14.1 kV run voltage, 40°C, electrokinetic injection 13 s at 10 kV system, Beckman P/Ace 5000 sample ISIS 2302 crude sample at concentration of 0.01 mg/mL... 

The commercially available 3-amino-1,2,4-dithiazole-5-one, (3), has been attached to a hydroxyl resin via a succinic acid linker, and has been used as an efficient sulfur-transfer reagent for the solution-phase synthesis of phos-phorothioates. DNA synthesis scale-up to lOOg of a 20-mer phosphorothioate has been examined " key to this was the purification of the product, which was carried out using a high efficiency polymeric anion exchange chromatographic media. 

As noted previously, studies of the mechanisms of phosphate monoester solvolysis have been extended to the mechanisms of the analogous phosphorothioate ester solvolysis because the thiometaphosphate anion is believed to be more stable than the metaphosphate anion. Thus, a general method based upon P NMR spectroscopy for the configurational analysis of chiral thiophosphate monoesters (see Fig. 10) was described recently by Cullis and co-workers (38). 

Anionic Sodium bis(2-ethylhexyl sulfosuccinate) [AOT] Bicyclic sulfonates Di(2-ethylhexyl) phosphoric acid [DEHPA] Di(2-ethylhexyl) phosphorothioic acid [DEPTA] Di(oleyl) phosphoric acid [DOLPA] Di(tridecyl) phosphoric acid Sodium dodecylbenzenesulfonate [SDBS]/1-butanol [4, and references therein] [5] [6,7] [8] [9,10] [11] [12]... 

In boiling xylene, 0-aryl 0-methyl O-2-propynyl phosphorothioates isomerize to 0-aryl 0-methyl 5-propadienyl phosphorothioates, although with only low to moderate conversions. The anions from the conventionally-synthesized mono-thiophosphate esters (76) (R = H or Ph, = H R R = (CH2)n, n = 3 or 4) rearrange, and on subsequent alkylation or acylation (R = Me, Et, Pr, Pr , Ac, Bu CO, (PhO)2P(X), X = O, S, or Se) yield the products (77) in the (Z) configuration the latter esters undergo Diels-Alder reactions with common dienophiles (e.g. acrylonitrile, acrolein, maleic anhydride, etc.) to give the systems... 

The pH dependent chemical hydrolyses of the phosphorothioate analogues 2 -, 3 - and 5 -UMPS have been investigated. Between pH 2 and 5 dethio-phosphorylation is between 200 and 300 times faster than dephosphorylation due to the higher stability of the intermediate thiometaphosphate compared to the metaphosphate anion. At pH values less than 1, no migration of the thio-phosphoryl group takes place but rather, desulfurisation occurs. 

The chemical and electrochemical oxidations of triphenylphosphine sulphide and phosphorothioates in acetonitrile have been investigated.In both reactions, triphenylphosphine sulphide initially gives a product formulated as a dimeric di-cation (39), but this rapidly decomposes on removal of the solvent or exposure to air. Triphenylphosphine oxide and sulphide form radical anions on treatment with potassium in ether at low temperature or by one-electron reduction at a Hg cathode in DMF. The photo-oxidation (sensitized by polymer-supported Rose Bengal) of triphenylphosphine selenide to the oxide has been shown to be highly solvent-dependent. 

In order to test the coordination ability of compound 12, the phenoxarsinine and phenothiarsinines with a bioactive cholesteryl group, viz. 13, were prepared by reacting 10-chloro-10//-phenothiarsinine 10 and 10-chloro-10//-phenox-arsinine 1 with compound 12. The latter is an anionic phosphorothioate ligand that incorporates a bioactive cholesteryl group, and was obtained from the phenyl phosphoramidate 11 (Scheme 6) <2000HAC6>. 

Pyridone and 2-pyridinethione anions react with (2,6> -diphenylphosphoro-chloridothioate to give C>,C> -[Pg.784]

Phosphates and phosphorothioates are insensitive to anion polarizability in this reaction. 2-Pyridone is a better nucleophile than 2-pyridinethione (relative rates = 28 1). The rates of these reactions have been correlated with acidities for several carboxylic acids, phenols, and thiophenols. ... 

Sulfurization of tricoordinated phosphorus compounds by treatment with 3H-1,2-benzodithiol-3-one 1,1-dioxide results from the nucleophilic attack of, for example, a phosphite triester on the electrophilic thiosulfonate function of 2 to produce the phos-phonium sulfinate intermediate 3 (eq 2). Intramolecular condensation of the sulfinate anion with the carbonyl group of the activated thiol ester function releases the phosphorothioate triester (4) with concomitant formation of 5. Because of the... 

However, addition of two phosphorothioate linkages results in four RNA isomers that can be resolved by anion-exchange chromatography using DNASwift SAX-IS (Figure 3.311b). 

---