PGEX vectors

Strugnell, S.A., B.A. Wiefling, and H.R Deluca, A modified pGEX vector with a C-terminal histidine tag recombinant double-tagged protein obtained in greater yield and purity. Anal Biochem, 1997. 254(1) 147-9. 

Vector DNA 150 ng/pL pGEX-6PDES A+destination vector Store at -20°C. 

High levels of recombinant C3 transferase have been expressed in E. coli using the glutathione S-transferase (GST) gene fusion vector, pGEX-2T (Pharmacia LKB Biotechnology, Inc). The GST-C3 expression vector was constructed in the laboratory of Dr. Larry Feig (Tufts Univer-... 

Figure 6 Different multiple cloning sites in different vectors, (a) MCS from pET-28a (Novagen, Madison, Wl). (b) MCS from pGEX-4T-1 (GE Healthcare, Piscataway, NJ). (c) pASK-IBA6 (IBA, Germany).

This procedure is used routinely for expression of protein from pRSET, pGEX and pET vectors (see Table 3.1). 

Glutathione-S-transferase (GST) expression vector. pGST-p (Panomics, Fremont, CA, USA) or pGEX-4T (GE Healthcare, Piscataway, NJ, USA). 

The multiple cloning site of pGEX-KG vector is modified by digestion with BamHl and EcoRI, and subsequently ligated with the annealed DNA duplex of two oligonucleotides (5 -GAT CAG AAT TCG CTA GCG... 

The region for mature protein of MGDG synthase cDNA was amplified by P( R. The amplified cDNA was inserted into the expression vector pGEX-3X to express the MGDG synthase as a fusion to glutathione -transferase (GST). XL 1-Blue was transformed with the constructs for the expression. 

Primer sequences consist of a 20- to 23-base section complementary to the relevant strand of the cDNA, with a restriction site added to the 5 end of each primer followed by a short 2-base extension to facilitate restriction enzyme activity. The 5 ends of each primer may be modified easily to subclone into different restriction sites of alternative vectors. For example, to clone hCRABP II into the pGEX-2T expression vector, new primers to incorporate BamHl and EcoBl sites (5 end S ACTGGATCCATGCCCAACTTCTCTGGCAAC. 3 end, s GATGAATTCCTCACTCTCGGACGTAGAC, restriction sites underlined) were used to subclone into the vectors in-frame with the glutathione-5-transferase (GST) coding sequence (14). 

---