TaqMan

Ngazoa, E. S., Fliss, I., and Jean, J. (2008). Quantitative study of persistence of human norovirus genome in water using TaqMan real-time RT-PCR. J. Appl. Microbiol. 104, 707-715. 

The three main categories of hybridization probes for real-time PCR are (1) cleavage based assays such as TaqMan, (2) displaceable probe assays such as Molecular Beacons and (3) probes which are incorporated directly into primers such as Scorpions. 

Real-time PCR is a quantitative method for measuring amplicons as they are produced by measuring the increase in fluorescence of a dye added to the reaction mixture.12,104,105 Methods using fluorescent reporters, such as SYBR Green,104,106 TaqMan ,107,108 or molecular beacons,9 collect quantitative data at the time when DNA is in the exponential phase of amplification. 

Kuboniwa, M. Amano, A. Kimura, K. R. Sekine, S. Kato, S. Yamamoto, Y. Okahashi, N. Iida, T. Shizukuishi, S. Quantitative detection of periodontal pathogens using real-time polymerase chain reaction with TaqMan probes. Oral Microbiol. Immunol. 2004,19,168-176. 

TaqMan (PE Biosystem) Moderate Very high Moderate High Integrated system... 

Medhurst AD et al. The use of TaqMan RT-PCR assays for semiquantitative analysis of gene expression in CN S tissues and disease models. J Neurosci Methods 2000 98 9-20. 

Variations If the sequence difference between miR family members resides in the last 6 base pairs, utilization of fluorescent probes (such as Taqman technology, as shown in Chen et al., 2005) will give optimal specificity. In the example in Fig. 6.4A and B, both let-7c and let-7a are detected, but because both target the RAS family (Johnson et al, 2005), there was no need to distinguish between these family members in this experiment. 

Cronin Breast cancer MasterPure TaqMan reactions RT-PCR analysis... 

D.A. Kulesh, R.O. Baker, B.M. Loveless, D. Norwood, S.H. Zwiers, E. Mucker, C. Hartmann, R. Herrera, D. Miller, D. Christensen, L.P. Wasieloski Jr., J. Huggins and P.B. Jahrling, Smallpox and pan-orthopox virus detection by real-time 3 -minor groove binder TaqMan assays on the Roche lightcycler and the Cepheid smart cycler platforms, J. Clin. Microbiol., 42 (2004) 601-609. 

Volkmann H, Schwartz T, Bischoff P et al (2004) Detection of clinically relevant antibiotic-resistance genes in municipal waste water using real-time PCR (TaqMan). J Microbiol Methods 56(2) 277-286... 

A. carbonarius naphto-4-pyrones, ochratoxin A Calmodulin gene quant, real-time PCR (TaqMan) 167 CARBO ql CARBO q2 probe CARBO probe CCGATGGAGGTCATGACATGA AATGCGAACCGGATATTAAdTCTG FAM-CAGCGGCGGAGATA-MGB Mule et al., 2006... 

RAPD marker quant, real-time PCR n.s. of Nicholson (TaqMan)... 

---