Gas promoters

Chiral 2,5-dihydrofuran can be prepared through the HC1 gas promoted cyclization of the corresponding optically active allenic hydroxy-ester 83 with almost complete axis chirality (87% ee) to center chirality (85% ee) transfer <00TL9613>. 

Hu, B., Yang, Y., and Sayari, A. (2001) Non-oxidative dehydroaromatization of methane over Ga-promoted Mo/ HZSM-5-based catalysts. Appl. Catal. A, 214, 95-102. 

In propylene epoxidation catalyzed by trimethylsilylated Au-Ba(N03)2/Ti-Si02, the introduction of the gas promoter trimethylamine (13-15 ppm) to the reactant gas stream appreciably improved catalytic performance [149] (Figure 3.20). Surprisingly, trimethylamine made the used catalysts better than fresh catalysts in catalytic performance. Possible reasons are (i) trimethylamine might destroy the mobile acid sites that appear and disappear intermittently, suppressing by-product formation from PO (ii) trimethylamine can also adsorb on the surfaces of Au and depress the combustion of H2 to form H20, thus leading to improved H2 utilization efficiency. 

Zn addition promotes C3H8 formation and restricts its reactivity Ga promotes alkene aromatization.65 ... 

Spent acid is sprayed into a decomposition furnace in the form of 500-1000 pm droplets (Dafft and White, 2002). The droplets present a large acid surface to the hot combustion gas, promoting rapid evaporation and decomposition. The droplets are most commonly produced by forcing the acid into the furnace through fine nozzles (Rohm and Haas, 2003 Bete, 2005). Spinning cup atomizers are also used. 

The oxide, M2O5, reacts with C starting at 435-675°C, depending on the system ". The presence of CO in the surrounding gas promotes the reaction initially, but high-T,... 

Experiments in the externally heated 5 lbs/hr CFR showed that methane, once formed, did not decompose under the stage 2 simulation achieved with this unit. However, because of the higher mixing temperatures attained in the PEDU, such decomposition is possible. To test whether methane does decompose, a stream of methane was injected into the simulated stage 1 gas where it experienced partial decomposition. The exact nature of the methane destruction is not clear. However it is most likely that the steam in the stage 1 gas promotes the reforming reaction ... 

The power, expressed as energy absorbed over the 10-minute run, was varied in several experiments and its effect on acetylene production is shown in Figure VI for three carrier gases, helium, argon, and hydrogen. The effects on other products are reported elsewhere (46). The higher concentration of H2 when it serves as the carrier gas promotes an increase of roughly 1.5 times the acetylene produced in either inert carrier. 

Primer 1 5 GTATACACGCTGGATCCGAACTCC Primer 2 5 GTTCAAGGCAGACATTGCTGAGGTGTAATGATGC GA promoter (PGA) pFE2... 

In atmospheric and some low- to medium-pressure processes, one or more separate oxidation-cooling units are often included prior to gas absorption. These units are built in the form of vertical towers which are cooled with external water curtains, shell-and-tube units, and also drum and cascade coolers. Excess air in the gas promotes initial oxidation, and some of the water vapor also present condenses to form weak nitric acid, which is later concentrated in the absorption section. Additional air for oxidation usually is injected at some point in the process, often in the absorption tower. In some plants, the gas is rapidly cooled to condense the water vapor without forming much weak acid, thereby helping to increase final acid concentration. A special condenseix yclone separator unit designed for this purpose is described by.Graham etal..[10]. 

J.A. Moreno, G. Poncelet, Isomerization of -butane over sulfated Al- and Ga-promoted zirconium oxide catalysts. Influence of promoter and preparation method, J. Catal. 203 (2001) 453—465. 

Carbide formation from the powdered elements is possible at 1050° (Hiittig et al, 1950). Below 650° this reaction leads mainly to W2C, but above this temperature WC is formed (Koto and Suzuki, 1948). The presence of H2 or a hydrocarbon gas promotes this reaction. 

There is some evidence for correlated changes in hormone levels and cell division activity. This is not proof of a cause/effect relationship, nor does it provide clues to the mechanism of putative cell cycle control by hormones. This will depend on more detailed biochemical analyses relating, for example, GA promotion of entry into S to specific GA effects on DNA synthesizing machinery. 

The presence of hydrocarbons and CO2 in the acid gas promotes the formation of COS and CS2 in the reaction furnace. These compounds can significantly contribute to SO2 in the incinerator. 

---