Base pair deletion

Simsek S., Admiraal L. G., Modderman P. W Van der School C. E., Von dem Borne A. E. G. K. Identification of a homozygous single base pair deletion in the gene coding for the human platelet glycoprotein Iba causing Bemard-Soulier syndrome. Thromb Haemost 1994 72,444-9. 

Known genetic lesions in MRP2 causing Dubin-Johnson syndrome are varied and range from point mutations to base pair deletions leading to missense muta-... 

Some 70 per cent of all cystic fibrosis patients exhibit a specific three-base-pair deletion in the gene, which results in the loss of a single amino acid (phenylalanine 508) from its final polypeptide product. Other cystic fibrosis patients display various other mutations in the same gene. 

Parahemophilia is an autosomal recessive bleeding disorder characterized by a reduced plasma concentration of the Factor V blood copulation protein. Deficiency arises from a 12 base-pair deletion in the Factor V gene that impairs the secretion of Factor V by hep-atocytes and results in an abnormal accumulation of immunoreactive Factor V antigen in the cytoplasm. In which region of the Factor V gene would this mutation most likely be located ... 

A 1-year-old toddler with cystic fibrosis (CF) is seen by his physician for an upper respiratory infection with Pseudomonas aeruginosa. He is started on oral norfloxacin and referred to a CF center as i potential candidate for gene therapy. Prior genetic testing of the patient identified the mutation causing cystic fibrosis as a 3-base-pair deletion in esan 10 of the CF gene. The nucleotide sequences f codons 506-511 in this region of the normal and mutant alleles are compared below. 

Lenz H-J, Zhang W, Zahedy S et al. A 6 base-pair deletion in the 3 UTR of the thymidylate synthase (TS) gene prediets TS mRNA expression in colorectal tumors a possible eandidate gene for eoloreetal cancer risk. Proc Am Assoc Cancer Res (Abstract) 2002 43. 

Mitochondrial Haplogroup B 9 base pair deletion 8215F 08195-08215 ACAGTTTCATGCCCATCGTC 55°C (59)... 

Sands, M. S. and Birkenmeier, E. FI. (1993). A single-base-pair deletion in the beta-glucuronidase gene accounts for the phenotype of murine mucopolysaccharidosis type VII. Proc. Natl. Acad. Sci. USA 90(14), 6567-6571. 

Molecular analysis of mtDNA from muscle biopsies often provides a definitive diagnosis of MELAS. Individuals with more severe clinical manifestations of MELAS generally have greater than 80% mutant mtDNA in postmitotic tissues such as muscle. In approximately 80% of MELAS cases, the responsible mutation is an A —> G base substitution at nucleotide position 3243. A smaller subset of MELAS patients (7.5%) possesses a different point mutation, aT C transition at nucleotide position 3271. At least eight additional point mutations and one four-base pair deletion mutation also have been described. 

Pig. 10 PARK2 PRKN structure. The general protein stmcture of parkin is shown (Schlehe et al., 2008). More than 100 mutations have been identified and are not shown here. Five common alterations account for 35% of aU PRKN mutations (1) deletions of exon 4 (u = 28), (2) deletions of exon 3 (n = 27), (3) deletions of exons 3-4 (n = 23), (4) a point mutation in exon 7 (924C>T n = 38), and (5) a single base pair deletion in exon 2 (255/256delA n = 17). Hotspots for common parkin mutations appear to be concentrated in exons 2-7, whereas hotspots for exon rearrangements are more likely to occur in introns 2-A (Hedrich et al., 2004). Scale is approximate... 

Ling M, McEachern G, Seyda A, MacKay N, Scherer SW, 25. Bratinova S, Beatty B, Giovannucci-Uzielli ML, Robinson BH. Detection of a homozygous four base pair deletion in the protein... 

A number of other mutations have been identified that result in ffameshifls and premature terminations. Within GPIIb, a large DNA deletion resulting in a prerrrature termination in intron 1 has been identified in patient KW and a deletion and premature termination in exon 15 caused by a splice site mutation has been identified in kindreds of the Gypsy peculation in France. Within GPIIIa, a 2 base-pair deletion in exon 6 was identified in patient LD and a deletion and premature termination in exon 3 caused by a splice site mutation was identified in patient Amsterdam l. ... 

Devalia V, Carter K, Walker AP, Perkins SJ, Worwood M, May A, Dooley JS. Autosomal dominant reticuloendothelial iron overload associated with a 3-base pair deletion in the ferroportin 1 gene (SLC11A3). Blood 2002 100 695-7. 

Fuchs S, Nakazawa M, MawM et al (1995) A homozygous 1 -base pair deletion in the arrestin gene is a frequent cause of Oguchi disease in Japanese. Nat Genet 10 360-362... 

Broly, F., and Meyer, U.A. Debrisoquine oxidation polymorphism Phenotypic consequences of a 3-base-pair deletion in exon 5 of the CYP2D6 gene. Pharmacogenetics 3(3) 123-130, 1993. 

Comparison of normal and aberrant PlG-A mRNA identifies a 207 base pair deletion, representing 69 amino acids in the PIG-A gene product [120]. In situ hybridization has localized the PIG-A gene to a p22.1 position on the X chromosome [120]. 

---