Oligonucleotides stock solutions

The concentrations of all oligonucleotide stock solutions are determined by their UV absorbance. Values of molar absorbtivity coefficients for the various bases at neutral pH are taken from CRC Press Handbook of Biochemistry and Molecular Biology. For heteropolymers, concentrations are determined at 260 nm by summing the absorbtivity coefficients for all bases in the oligomer and using Beers Law, Homopolymers are similarly quantitated at their respective wavelength of maximum absorbance. 

The majority of fluorescent probes are water-insoluble and must be dissolved in an organic solvent prior to addition to an aqueous reaction medium containing the DNA to be labeled. Suitable solvents are identified for each fluorophore, but mainly DMF or DMSO are used to prepare a stock solution. Some protocols utilize acetone when labeling DNA. However, avoid the use of DMSO for sulfonyl chloride compounds, as this group reacts with the solvent. For oligonucleotide labeling, the amount of solvent added to the reaction mixture should not exceed more than 20% (although at least one protocol calls for a 50% acetone addition—Nicolas etal., 1992). 

Stock solutions (lmg/ml) of the oligonucleotides were prepared and kept frozen. The washing and measurement buffer was ABS. The dilution and hybridisation buffer was the 2 x SSC. 

Label the oligonucleotides. Prepare the labeling reaction with distilled water to a final volume of 25 pL containing 200 ng of oligonucleotide, 5 pL of 5X labeling buffer, 1 pL of C0CI2 stock solution, 2.5 pL of DIG-11-dUTP, and 1 pL of terminal transferase. Permit the reaction to proceed for 15 min at 37 C (see Notes 7 and 8). 

Oligonucleotide primers. 5 -primer AAGATAAGCTTACATAATCACATGGA, 3 -primer CCTATGAAATCC ITT GCTGCACATGT. A stock solution of these primers is 100pM and should be kept frozen in ahquots at -20°C. 

On the third day of oligonucleotide treatment, add 3 iL of RA stock solution (1 mg/mL) (see Note 2) to each culture plate, giving a final concentration of 3 3 iM... 

Upstream Oligonucleotide Primer 50 pM stock solution of the oligonucleotide dissolved m nuclease-free water (see Note 5 and Table 1). 

Gel-purified oligonucleotides are dissolved in distilled water at stock solution of 100 pM. 

---