CDNA chip

Chip technology holds considerable promise for identifying differentially expressed proteins and would be an excellent complement to cDNA chip technology. 

CATCTCTTGCTCGAAGTCCA) gene. The PGR products were then loaded on agarose gel electrophoresis for separation and visualization. The results show that the c-fos mRNA was induced at 30 minutes followed hy a decrease at 1 hour, whereas the VDUP-1 mRNA synthesis showed a linear increase. The results also agree with cDNA-chip hybridization detection data. 

In summary, microarray analysis with cDNA-chips containing a large number of known genes and EST cDNA (usually >10,000-dot) is a valuable means of investigating alterations in gene expression. 

Array types There are two main types of arrays (i) oligonucleotide and (ii) cDNA arrays. In the first type short 20-25mers are synthesized on a silica chip... 

Abbreviation Bp, nucleotide base pairs cDNA, complementary DNA ChIP, chromatin Immunoprecipi-tation Cy5, cyanine 5-dCTP Cy3, cyanine 3-dCTP ESTs, expressed sequence tags FDR, false discovery rate MIAME, minimum information about a microarray experiment mRNA, RNA, messenger NIA, National Institutes of Aging RFUs, relative fluorescence units RT-PCR, reverse transcriptase polymerase chain reaction SAGE, serial analysis of gene expression SAM, significance analysis of microarrays... 

Afiymetrix chips across different generations and cDNA microarrays are common platforms used to identify gene expression-based signatures for breast cancer prognosis... 

The choice of DNA array depends on cost, density, accuracy, and the type of DNA to be immobilized on the surface. The first criteria should be whether the chips contain immobilized cDNAs or shorter oligonucleotide sequences. The former must be spotted on the chips as complete molecules, but oligos can either be spotted or synthesized on the surface of a chip. The final criteria to select a chip should be whether the user makes or purchases the chip. Homemade systems offer limited number of spotting samples. 

---