Vesperal

The cocktail appears in the book and is named for Vesper Lynd, the double agent who is Bond s lady interest until her suicide over split allegiances to the free world and the evil empire of the Soviet Union. Bond dedicates the drink to the violet hour, a beautiful evocation of the ethos of the cocktail. Nice, Sir James. 

The Vesper itself is a double agent, and the Cold War in a glass— both gin and vodka, in deference to Britain and Russia, and Lillet, with a twist of lemon. Every liaison requires lingerie and something tart, right ... 

But the Lillet is what keeps the cocktail s gin-to-vodka fusion in check, or it s just another drink fatale. Bond was originally a gin drinker, appropriately for an English agent, and the Vesper was a gin... 

At Pravda, at 281 Lafayette Street in New York, Jason Kosmas, the bar manager, makes his Vesper as if it were being served behind tire Iron Curtain, with three parts vodka to one part gin, a reverse of the original recipe. Pravda is a vodka bar, and Mr. Kosmas thinks vodka is what people want at the moment. 

The Vesper has a reputation for being an aphrodisiac, but what wouldn t with a short list of strong liquors in it ... 

The Gimlet, 181 Jefferson Bloody Mary, 104 Long Island Iced Tea, 32 Martini Rossi Rosso, 59 Mello Jell-O Shot, 35 Minnesota Antifreeze, 48 The Pink Puppy, 48 Raspberry Caipiruska, 16 Red Snapper, 193 Shanghai Cosmo, 52 The Snack Bar Pitcher, 23 Sparkling Mango, 10 That Stinger, 128 Tablatini, 138 Titanic, 28 Town Plum, 215 The Vesper, 79 Way of the Dragon, 178 White Hot Martini, 198 Wolf s Royal Cream Soda, 113... 

S. J. Vesper, Production of pili (fimbriae) by Pseudomonmas fluorescens and correlation with attachment to corn roots. Applied and Environmental Microbiology 53 1397 (1987). 

The word placebo is Latin for I shall please . The medical use of the term evolved from its use in the Catholic rite of Vespers of the Office of the Dead, in which the congregation chants the words, placebo Domino in regione vivorum (I shall please the Lord in the land of the living). In medieval France, people who did not know the deceased sometimes came to funerals with the hope of sharing in the food and drinks that were distributed afterwards. These people came to be known as placebo singers . 

Scheme 56 summarizes Mori s synthesis of (S)-vesperal (38), the female sex pheromone of the longhorn beetle (Vesperus xatarti) [85]. (F)-Limonene yielded (S)-38 by utilizing organoselenium chemistry. 

It is a viral hemorrhagic fever normally found in Bolivia. The natural reservoir is the vesper mouse (Calomys callosus) and the virus is shed in their urine. Infection occurs after inhalation of dust contaminated with excreta from infected mice or from aerosol of animal blood or fluids. Does not produce disease in animals. This is a biosafety level 4 agent. 

It was a Sunday evening in early June and the hour for Vesper service at Saint Zita s convent. Reverend Mother mounted the staircase leading to the chapel, then paused, with her hand upon the door, to listen as the wonderful soprano again took up the refrain ... 

Vesper JL. Documentation Systems, Clear and Simple, Interpharm Press, Buffalo Grove, IE, 1998. 

Hansgen KD, Vesper J, Ploch M. (1994). Multicenter double-blind study examining the antidepressant effectiveness of the hypericum extract LI 160. J Geriatr Psychiatry Neurol. 7(suppl 1) S15-8. 

A short route to synthesize vesperal, (S)-lO-oxoisopip-eritenone, the female sex ph eromone of the longhorn beetle Vesperus xatarti has been reported. ... 

A. alternata see A. alternata rRNA gene, ITS1-5.8S-ITS2 region PCR 450 Aalt-F Aalt-R GGCGGGCTGGAACCTCTCGG AATGGATGCTAGACCnTGC Haugland and Vesper, 2(X)0 Zur et ah, 2002... 

AversRl probe AversPl CCATTGTTGAAAGTTTTGACTGATTTTA FAM-AGACTGCATCACTCT CAGGCATGAAGTTCAG-TAMRA Vesper, 2000... 

---