Ladder sequencing oligonucleotides

In the ladder sequencing method, the oligonucleotide is enzymatically digested to subsequently remove either 3 - or 5 -terminal residues. The sequence can be derived from the mass change after each cleavage. Ladder sequencing was demonstrated using either MALDI-MS or ESI-MS [27]. 

Figure 13.14. Basic concept of the ladder sequencing protocol. The oligonucleotide 5 -ATCTCGATC- 3 is treated with SVP or CSP to generate 5 - or to generate 3 -ladders, respectively. (From ref. 73.)...

Figure 13.15. Example of the ladder sequencing method. Overlaid reconstructed molecular weight spectrum of a 33-mer oligonucleotide, d(GCCAGGGTTTTCCCAGTCACG ATGCAGAATTCA), from SVP and bovine alkaline phosphatase digestion. (Reproduced from ref. 75 by permission of Elsevier, copyright 2001.)...

This approach to analyze exonuclease ladders seems to be a particularly promising tool to determine rapidly the sequence of oligonucleotides. Compared to conventional methods, based on the laboratory-scale preparation of a large number of samples at different enzyme and substrate concentrations followed by MALDI-MS analysis, the microfluidics approach offers the advantage of saving time and material. Furthermore, due to the limited sample handling, the risks encountered when manipulating biomolecules are also reduced as well as that of sample contamination. 

The MALDI-technique is not limited to proteins/peptides. With a suitable matrix you can also bring DNA and RNA into the gas phase. What for For example, you can sequence oligos by means of oligonucleotide ladders (Limbach et al. 1995). The smallest MW difference between DNA bases—between adenine and thymine—amounts to at least 9 Dalton. For RNA bases, the smallest difference—between cytosine and uracil—lies at 1 Dalton. 

Fig. 10.15 Two strands of oligonucleotides sequenced 5 -CAAAGAAAAG-3 and 5 -CTTTTCTTTG-3 assemble into a double helix. The structure has been determined by X-ray diffraction [M. L. Kopka et al. (1996) J. Mol. Biol., vol. 334, p. 653], The backbone of each oligonucleotide is depicted as an arrow pointing towards the C3 end of the sequence, and the nucleobases are shown in a ladder representation. The nucleobases are colour coded G, green A, red C, purple T, turquoise.

The oligonucleotide 5 -snake venom phosphodiesterase. At what m/z values will the 5 -sequence ladders be seen in the negative-ion MALDI mass spectrum ... 

FIGURE 11.5 Scheme for oligonucleotide sequencing by gel-electrophoretic separation of four dideoxy-terminated Sanger ladders. 

---