Strand-switching

Figure 6. Solid-support-based protocol for the synthesis of a quadrilateral. Beginning with the support containing a closed junction, alternate cycles of restriction and ligation are performed, always at the position indicated as 1 . Selection of the target product (triangle, quadrilateral, pentalateral,...) is determined by the point at which one chooses to restrict at site 2, exposing a sticky end complementary to that exposed by restriction at site 1. This action corresponds to a strand switch (eliminating a zero node), of the sort shown in Figure 8, below. This is emphasized by the lines of different thickness with which the square catenane is drawn.

Figure 8. Zero node operations, (a) Strand switch to remove nodes in knots and catenanes. On the left is a 5-noded knot (50, with its polarity indicated by arrowheads. Passing to the middle, one strand switch has been performed, converting the knot to a catenane, drawn with lines of two different thicknesses. On the right, another strand switch has been performed, making a new 3-noded knot, (b) A strand switch in a DNA context. Backbones are indicated by thick arrows, held together by three base pairs on each side. The helix axis is horizontal, and the dyad axis is vertical. The strand switch reconnects the strands, but maintains polarity. The reaction symbol replaces the right directional in (a), (c) View down the dyad axis. The view in (b) has been rotated 90° about the horizontal axis. The hairpin nature of the product is clear here. It should be clear that the leftward reaction shown here is identical to the ligation shown in the last step of Figure 6.

Py Pu Py base triplets as shown in (237). This polanty of binding does not require a special junction such as the 3 -3 linkage previously used between two oligopyrimidine blocks.These results indicate that by using both the known types of base triplets in combination with strand switching the requirement of purely homopurine sequences for triplex formation can be relaxed. 

SWITCH2 CGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCTGGG Strand switching (Methods 2 and 3)... 

The SWITCH2 primers consist of a segment that is compatible with Illumina sequencing, a random sequence, a bar code, and a 3 GGG. The GGG is intended to promote strand-switching by the SMARTScribe reverse transcriptase. 

Strand-switching using GGG attached to the second platform-specific sequencing adapter (> ), resulting in addition of the second platform-specific adapter ( ) to... 

The design of the strand-switching primer is informed by the reported properties of the reverse transcriptase and studies that... 

---