Ribosubstitution method

In the ribosubstitution method these problems are circumvented by the addition of one or more ribonucleotides between the DNA primer and the radioactive cDNA. This site is susceptible to cleavage with ribonuclease or alkali. This method can also be used in conjunction with other primed synthesis methods for DNA sequencing (Barnes, 1978 Sanger, Nicklen and Coulson, 1977). 

Fig. 2.6. Principle of the single-site ribosubstitution method using an Alul fragment as primer (from Brown, 1978). The inserted ribocytidine residue is...

Fig. 3.7. Principle of the partial ribosubstitution method of Barnes (1978). iC, rA, inserted ribocytidine and riboadenine residues N, any deoxynucleotide.

Fig. 3.8. Line diagram of a sequencing gel (Baines, 1978) showing application of the partial ribosubstitution method to the analysis of a cloned DNA sequence. Sequence deduced AAAAGTGGTTTAGGTTAAAAGGTATC AAATG AAT AAGC ATTCGATCGG AA r till. .. xc, position of the xylene-cyanol FF dye...

A unique variation of the nucleotide sequencing that exploits the relaxed specificity of Pol Ik in the presence of Mn is the method of partial ribonucleotide substitution (65). A DNA synthesis is carried out in the presence of Mn ", all four dNTPs, and one of the four rNTPs under the conditions that result in 2% ribonucleotide substitution. The cleavage of the products at the positions of partial ribosubstitution by alkali (0.3 M KOH -I- 10% piperidine) results in a ladder of fragments terminated by the respective ribonucleotides. 

---