Extended aptamers

Fig. 1. Adaptation of anti-cell aptamers to PLA. Anti-PSMA aptamers were extended at the 3 and the 5 end and DNA probes were hybridized to the extended aptamers. When bound to adjacent sites on a cell surface the oligonucleotides (one of which contained a 5 phosphate) could be aligned by a splint oligonucleotide and subsequently be ligated and amplified. The new amplicon is detected by real-time PCR.

PLAprobes PLA probes to hybridize to the S - and S -extended aptamers were as follows ... 

PLA probe hybridized to the S end of the extended aptamer A9 5 pGTCAT CATT CGAATCGTACTGCAATCGGGTATTAT TTATATTTCAATATTCTCCC 3 (IDT, Coralville, IA). 

Aptamers appear to display low immunogenicity but, when administered systemically, they are quickly excreted via size-mediated renal clearance. In order to prevent renal removal, such aptamers are usually conjugated to PEG. PEG may also help further protect the aptamers from degradation by serum nucleases native aptamers are prone to nuclease attack, but their half-lives can most effectively be extended via chemical modification, as discussed earlier in the context of antisense agents. 

Dougan H, Lyster DM, Vo CV, Stafford A, Weitz JI, Hobbs JB, Extending the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood, Nucl. Med. Biol., 27 289-297, 2000. 

Hlwang B, Lee SW, Improvement of RNA aptamer activity against myasthenic autoantibodies by extended sequence selection, Biochem. Biophys. Res. Commun., 290 656-662, 2002. 

The IUPAC definition may also be extended in respect to biomimetic recognition elements, e.g., aptamers and molecularly imprinted polymers, which are derived from biology (Table). 

The sequences of the extended A9 aptamer were as listed in Subheading 2.3, step 1... 

Hwang, B., Lee, S. W. (2002). Improvement of RNA aptamer activity against myasthenic antoantibodies by extended seqnence selection. Biochem Biophys Res Commun 290, 656-662. 

Asymmetric PCR with the excess of the primer that is extended to aptamer candidates over the primer that is extended to complementary aptamer sequences has been used successfully in quick testing of affinity between rounds of SELEX. Asymmetric PCR is slower, but it allows us to avoid the strand separation procedure, as complementary strands are generated in small amounts and affect... 

So L-oligonucleotides are expected to be unsusceptible to naturally occurring enzymes. This concept has been applied successfully to create a biostable RNA CSP. It was demonstrated that a chiral stationary phase based on l-RNA (i.e., the mirror image of the natural d-RNA aptamer) was stable for an extended period of time (about 1600 column volumes of mobile phase) under the usual chromatographic conditions of storage and experiments. In addition, as expected... 

---